\
| Variant ID: vg0221860877 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 21860877 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 250. )
ATCAACAATATCGATGTACGTTTATTGATCTAATCCCTTATGAAAGGTGTTGTCTTGAAATTGTTGTGGTGAAAACCTAACTTTTTGATAGGACAATATG[G/C]
TAAACATATATATATGATATTTTCTTTAGGAAGGTACTATCGCAGTCTCTTGGAGAGTGCCTCGTTTGCATAGATGGCCTTCATGTATTCTCTTTTCATC
GATGAAAAGAGAATACATGAAGGCCATCTATGCAAACGAGGCACTCTCCAAGAGACTGCGATAGTACCTTCCTAAAGAAAATATCATATATATATGTTTA[C/G]
CATATTGTCCTATCAAAAAGTTAGGTTTTCACCACAACAATTTCAAGACAACACCTTTCATAAGGGATTAGATCAATAAACGTACATCGATATTGTTGAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.50% | 4.80% | 0.68% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 83.10% | 14.80% | 2.05% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 92.60% | 5.20% | 2.22% | 0.00% | NA |
| Tropical Japonica | 504 | 71.00% | 27.00% | 1.98% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.40% | 19.90% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 3.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0221860877 | G -> C | LOC_Os02g36220.1 | intron_variant ; MODIFIER | silent_mutation | Average:43.026; most accessible tissue: Zhenshan97 young leaf, score: 53.969 | N | N | N | N |
| vg0221860877 | G -> C | LOC_Os02g36220.2 | intron_variant ; MODIFIER | silent_mutation | Average:43.026; most accessible tissue: Zhenshan97 young leaf, score: 53.969 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0221860877 | NA | 7.37E-06 | mr1502 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221860877 | NA | 4.28E-09 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221860877 | 6.91E-11 | 4.22E-16 | mr1871 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221860877 | 3.40E-12 | 1.27E-15 | mr1042_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221860877 | 9.73E-06 | 2.13E-08 | mr1502_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221860877 | 5.53E-07 | 7.57E-11 | mr1543_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221860877 | 5.45E-06 | 1.15E-07 | mr1680_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221860877 | 4.11E-10 | 8.77E-15 | mr1742_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221860877 | 1.08E-18 | 4.38E-23 | mr1871_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |