\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221859377:

Variant ID: vg0221859377 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21859377
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCACATGACGGTTTAGTAGCATTTGTTGAAGTGCAATGTAAGGATTAAGAGCGTTTCTAGAAAGTTTAATAAAATTTTAGTATATAATAGATAGATGACT[A/G]
TTAGTTTATAGGGAGAATACAACAAAAAGCACTTGCGAGCTACTTTTCTGTTTCATATTATAAGTCGCTTTTGACTTTATTTTGTTATCGAGTTTATGAA

Reverse complement sequence

TTCATAAACTCGATAACAAAATAAAGTCAAAAGCGACTTATAATATGAAACAGAAAAGTAGCTCGCAAGTGCTTTTTGTTGTATTCTCCCTATAAACTAA[T/C]
AGTCATCTATCTATTATATACTAAAATTTTATTAAACTTTCTAGAAACGCTCTTAATCCTTACATTGCACTTCAACAAATGCTACTAAACCGTCATGTGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.40% 23.70% 2.41% 0.53% NA
All Indica  2759 94.10% 1.20% 3.84% 0.83% NA
All Japonica  1512 35.70% 64.00% 0.20% 0.07% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 89.90% 0.20% 8.91% 1.01% NA
Indica II  465 94.60% 0.60% 3.23% 1.51% NA
Indica III  913 96.20% 1.40% 1.53% 0.88% NA
Indica Intermediate  786 94.70% 2.00% 3.05% 0.25% NA
Temperate Japonica  767 52.80% 47.10% 0.13% 0.00% NA
Tropical Japonica  504 21.00% 79.00% 0.00% 0.00% NA
Japonica Intermediate  241 12.00% 86.70% 0.83% 0.41% NA
VI/Aromatic  96 11.50% 87.50% 1.04% 0.00% NA
Intermediate  90 56.70% 37.80% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221859377 A -> G LOC_Os02g36220.1 intron_variant ; MODIFIER silent_mutation Average:18.475; most accessible tissue: Callus, score: 33.164 N N N N
vg0221859377 A -> G LOC_Os02g36220.2 intron_variant ; MODIFIER silent_mutation Average:18.475; most accessible tissue: Callus, score: 33.164 N N N N
vg0221859377 A -> DEL N N silent_mutation Average:18.475; most accessible tissue: Callus, score: 33.164 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221859377 9.29E-07 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221859377 7.52E-06 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221859377 2.12E-06 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221859377 NA 6.81E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221859377 1.00E-06 1.00E-06 mr1186_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221859377 8.04E-06 8.04E-06 mr1245_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221859377 NA 5.82E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221859377 5.43E-08 NA mr1305_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221859377 5.93E-06 4.47E-06 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221859377 NA 5.01E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221859377 NA 1.20E-11 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221859377 NA 2.17E-08 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221859377 2.04E-06 2.15E-10 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221859377 NA 7.29E-07 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221859377 9.85E-09 NA mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221859377 2.87E-06 2.87E-06 mr1647_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221859377 NA 2.15E-06 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221859377 8.30E-06 NA mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221859377 NA 1.94E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221859377 3.55E-06 2.02E-12 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221859377 NA 3.77E-06 mr1977_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251