\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221849531:

Variant ID: vg0221849531 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21849531
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTGGCTTCTAGCAGTGGCGCTGTAAACATGAAAAACATAAGGGTGTTTCCGAAAAACAAACATATTTATCTCCAAACCCTATCCCCGGCCATCTCCCAC[C/T]
TCCTCCACCCCGCGCCCCACTCAAGCTCTGCGCTCAACACCGACGCCGACACGGGGCTGCCTCCGACATTGTCCACAAATTTTATGGTTTTATAACATTG

Reverse complement sequence

CAATGTTATAAAACCATAAAATTTGTGGACAATGTCGGAGGCAGCCCCGTGTCGGCGTCGGTGTTGAGCGCAGAGCTTGAGTGGGGCGCGGGGTGGAGGA[G/A]
GTGGGAGATGGCCGGGGATAGGGTTTGGAGATAAATATGTTTGTTTTTCGGAAACACCCTTATGTTTTTCATGTTTACAGCGCCACTGCTAGAAGCCAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.70% 9.60% 5.69% 8.02% NA
All Indica  2759 98.90% 0.30% 0.29% 0.43% NA
All Japonica  1512 36.60% 25.90% 15.54% 21.89% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.60% 0.20% 0.00% 0.22% NA
Indica III  913 98.80% 0.30% 0.11% 0.77% NA
Indica Intermediate  786 98.10% 0.50% 0.89% 0.51% NA
Temperate Japonica  767 53.60% 16.90% 16.30% 13.17% NA
Tropical Japonica  504 21.60% 35.70% 12.10% 30.56% NA
Japonica Intermediate  241 14.10% 34.00% 20.33% 31.54% NA
VI/Aromatic  96 13.50% 41.70% 20.83% 23.96% NA
Intermediate  90 66.70% 13.30% 6.67% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221849531 C -> T LOC_Os02g36210.1 downstream_gene_variant ; 1694.0bp to feature; MODIFIER silent_mutation Average:43.196; most accessible tissue: Zhenshan97 young leaf, score: 60.208 N N N N
vg0221849531 C -> T LOC_Os02g36220.1 downstream_gene_variant ; 3962.0bp to feature; MODIFIER silent_mutation Average:43.196; most accessible tissue: Zhenshan97 young leaf, score: 60.208 N N N N
vg0221849531 C -> T LOC_Os02g36220.2 downstream_gene_variant ; 3962.0bp to feature; MODIFIER silent_mutation Average:43.196; most accessible tissue: Zhenshan97 young leaf, score: 60.208 N N N N
vg0221849531 C -> T LOC_Os02g36210-LOC_Os02g36220 intergenic_region ; MODIFIER silent_mutation Average:43.196; most accessible tissue: Zhenshan97 young leaf, score: 60.208 N N N N
vg0221849531 C -> DEL N N silent_mutation Average:43.196; most accessible tissue: Zhenshan97 young leaf, score: 60.208 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221849531 NA 2.34E-09 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531 9.38E-07 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531 NA 2.33E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531 1.18E-06 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531 NA 1.81E-11 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531 5.01E-06 5.01E-06 mr1186_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531 1.65E-07 NA mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531 6.29E-06 3.88E-06 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531 NA 3.26E-13 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531 NA 5.48E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531 NA 1.79E-08 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531 1.48E-07 2.22E-11 mr1559_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531 7.65E-06 1.21E-07 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531 2.96E-08 NA mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531 4.10E-06 4.10E-06 mr1649_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531 NA 4.68E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531 6.72E-06 4.66E-12 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251