Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221849531:

Variant ID: vg0221849531 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 21849531
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTGGCTTCTAGCAGTGGCGCTGTAAACATGAAAAACATAAGGGTGTTTCCGAAAAACAAACATATTTATCTCCAAACCCTATCCCCGGCCATCTCCCAC[C/T]
TCCTCCACCCCGCGCCCCACTCAAGCTCTGCGCTCAACACCGACGCCGACACGGGGCTGCCTCCGACATTGTCCACAAATTTTATGGTTTTATAACATTG

Reverse complement sequence

CAATGTTATAAAACCATAAAATTTGTGGACAATGTCGGAGGCAGCCCCGTGTCGGCGTCGGTGTTGAGCGCAGAGCTTGAGTGGGGCGCGGGGTGGAGGA[G/A]
GTGGGAGATGGCCGGGGATAGGGTTTGGAGATAAATATGTTTGTTTTTCGGAAACACCCTTATGTTTTTCATGTTTACAGCGCCACTGCTAGAAGCCAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.70%	9.60%	5.69%	8.02%	NA
All Indica	2759	98.90%	0.30%	0.29%	0.43%	NA
All Japonica	1512	36.60%	25.90%	15.54%	21.89%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.60%	0.20%	0.00%	0.22%	NA
Indica III	913	98.80%	0.30%	0.11%	0.77%	NA
Indica Intermediate	786	98.10%	0.50%	0.89%	0.51%	NA
Temperate Japonica	767	53.60%	16.90%	16.30%	13.17%	NA
Tropical Japonica	504	21.60%	35.70%	12.10%	30.56%	NA
Japonica Intermediate	241	14.10%	34.00%	20.33%	31.54%	NA
VI/Aromatic	96	13.50%	41.70%	20.83%	23.96%	NA
Intermediate	90	66.70%	13.30%	6.67%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221849531	C -> T	LOC_Os02g36210.1	downstream_gene_variant ; 1694.0bp to feature; MODIFIER	silent_mutation	Average:43.196; most accessible tissue: Zhenshan97 young leaf, score: 60.208	N	N	N	N
vg0221849531	C -> T	LOC_Os02g36220.1	downstream_gene_variant ; 3962.0bp to feature; MODIFIER	silent_mutation	Average:43.196; most accessible tissue: Zhenshan97 young leaf, score: 60.208	N	N	N	N
vg0221849531	C -> T	LOC_Os02g36220.2	downstream_gene_variant ; 3962.0bp to feature; MODIFIER	silent_mutation	Average:43.196; most accessible tissue: Zhenshan97 young leaf, score: 60.208	N	N	N	N
vg0221849531	C -> T	LOC_Os02g36210-LOC_Os02g36220	intergenic_region ; MODIFIER	silent_mutation	Average:43.196; most accessible tissue: Zhenshan97 young leaf, score: 60.208	N	N	N	N
vg0221849531	C -> DEL	N	N	silent_mutation	Average:43.196; most accessible tissue: Zhenshan97 young leaf, score: 60.208	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221849531	NA	2.34E-09	mr1097	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531	9.38E-07	NA	mr1210	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531	NA	2.33E-06	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531	1.18E-06	NA	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531	NA	1.81E-11	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531	5.01E-06	5.01E-06	mr1186_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531	1.65E-07	NA	mr1305_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531	6.29E-06	3.88E-06	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531	NA	3.26E-13	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531	NA	5.48E-06	mr1379_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531	NA	1.79E-08	mr1554_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531	1.48E-07	2.22E-11	mr1559_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531	7.65E-06	1.21E-07	mr1559_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531	2.96E-08	NA	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531	4.10E-06	4.10E-06	mr1649_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531	NA	4.68E-06	mr1765_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221849531	6.72E-06	4.66E-12	mr1947_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251