\
| Variant ID: vg0221847467 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 21847467 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AATCGATGGGCACATCTCCAAGGTTTTGTTCGAGGATGTCAATTAGGAAAATGGTTGACTACTAGAAAGGCAATAAAAACAAGAGTTGTGTCTACCAGCA[T/C]
GGCTCGTAAAGTGATGACTGCGAAAATTTTCTCAAAGTGAGATGAATTTAGTCGATATTTGTTTCACTTGATGGTACACCAGATACACATGTTGTTATAA
TTATAACAACATGTGTATCTGGTGTACCATCAAGTGAAACAAATATCGACTAAATTCATCTCACTTTGAGAAAATTTTCGCAGTCATCACTTTACGAGCC[A/G]
TGCTGGTAGACACAACTCTTGTTTTTATTGCCTTTCTAGTAGTCAACCATTTTCCTAATTGACATCCTCGAACAAAACCTTGGAGATGTGCCCATCGATT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.50% | 23.50% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 36.30% | 63.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 53.60% | 46.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 21.00% | 79.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 13.30% | 86.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 13.50% | 86.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 36.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0221847467 | T -> C | LOC_Os02g36210.1 | 3_prime_UTR_variant ; 55.0bp to feature; MODIFIER | silent_mutation | Average:36.289; most accessible tissue: Callus, score: 76.43 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0221847467 | NA | 2.94E-10 | mr1097 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221847467 | NA | 5.98E-13 | mr1205 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221847467 | 1.63E-06 | NA | mr1543 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221847467 | NA | 4.57E-07 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221847467 | NA | 2.69E-12 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221847467 | 6.91E-06 | 6.35E-20 | mr1042_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221847467 | 2.34E-07 | 2.34E-07 | mr1186_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221847467 | 8.44E-07 | NA | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221847467 | NA | 6.10E-06 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221847467 | NA | 1.29E-10 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221847467 | 1.86E-06 | NA | mr1543_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221847467 | NA | 4.84E-09 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221847467 | NA | 2.64E-06 | mr1554_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221847467 | NA | 1.29E-09 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221847467 | NA | 8.22E-06 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221847467 | 4.55E-06 | NA | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221847467 | 1.41E-06 | 1.41E-06 | mr1647_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221847467 | NA | 1.07E-06 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221847467 | 4.65E-07 | NA | mr1742_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221847467 | 4.06E-06 | NA | mr1871_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221847467 | 1.05E-06 | 6.23E-13 | mr1947_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221847467 | NA | 2.15E-06 | mr1977_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |