\
| Variant ID: vg0221844814 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 21844814 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTACGTACTGTTGCAAAATTGATAAATATATGGTTAATTGTATTTAATTTGTTACTACTAAATATTAGTAATGCATAGGGAAATTTGGCACAGCATATTT[G/A]
TTCCATCCTACTGAAATTTGACAATTCTACCAAATCTACCGAAAATTTGGTATTGCTAAATTTTTTTGAACAGAAATATTGTCAAATTTTGGTGAACATG
CATGTTCACCAAAATTTGACAATATTTCTGTTCAAAAAAATTTAGCAATACCAAATTTTCGGTAGATTTGGTAGAATTGTCAAATTTCAGTAGGATGGAA[C/T]
AAATATGCTGTGCCAAATTTCCCTATGCATTACTAATATTTAGTAGTAACAAATTAAATACAATTAACCATATATTTATCAATTTTGCAACAGTACGTAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.00% | 8.40% | 5.35% | 9.27% | NA |
| All Indica | 2759 | 98.90% | 0.40% | 0.22% | 0.40% | NA |
| All Japonica | 1512 | 37.30% | 22.50% | 15.34% | 24.87% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.80% | 0.30% | 0.22% | 0.66% | NA |
| Indica Intermediate | 786 | 98.10% | 0.80% | 0.51% | 0.64% | NA |
| Temperate Japonica | 767 | 54.40% | 11.20% | 15.38% | 19.04% | NA |
| Tropical Japonica | 504 | 21.80% | 32.90% | 14.48% | 30.75% | NA |
| Japonica Intermediate | 241 | 15.40% | 36.50% | 17.01% | 31.12% | NA |
| VI/Aromatic | 96 | 14.60% | 36.50% | 11.46% | 37.50% | NA |
| Intermediate | 90 | 67.80% | 12.20% | 4.44% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0221844814 | G -> A | LOC_Os02g36210.1 | intron_variant ; MODIFIER | silent_mutation | Average:50.864; most accessible tissue: Callus, score: 68.704 | N | N | N | N |
| vg0221844814 | G -> DEL | N | N | silent_mutation | Average:50.864; most accessible tissue: Callus, score: 68.704 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0221844814 | NA | 3.89E-10 | mr1097 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221844814 | NA | 3.51E-10 | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221844814 | 4.90E-06 | 1.06E-19 | mr1042_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221844814 | NA | 2.29E-06 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221844814 | 1.67E-07 | 1.67E-07 | mr1186_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221844814 | 4.42E-06 | 4.42E-06 | mr1245_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221844814 | NA | 1.59E-06 | mr1278_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221844814 | 1.10E-06 | NA | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221844814 | NA | 3.07E-06 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221844814 | NA | 4.51E-11 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221844814 | NA | 5.41E-08 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221844814 | NA | 8.94E-10 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221844814 | NA | 7.13E-06 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221844814 | 1.04E-08 | NA | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221844814 | 5.19E-07 | 5.19E-07 | mr1647_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221844814 | 2.79E-06 | NA | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221844814 | 9.65E-06 | NA | mr1742_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221844814 | NA | 5.40E-09 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221844814 | NA | 1.36E-11 | mr1947_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221844814 | NA | 9.65E-07 | mr1977_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |