\
| Variant ID: vg0221843984 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 21843984 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTTTTCCCAAAAACATCACATCGAATCTTTGAATATATGTATGAAGCATTAAATATAGATAAAGTGAAAAACTAACTGCACAGTTTGGAAATCGCGAGAC[G/T]
AATCTTTTGTGCCTAATTAGTCTATGATTAGCCATAAGTGCTACATGCAACCCACATACGCTAATAATGGATTAATTAGGCTTAATAAATTCGTCTCGTG
CACGAGACGAATTTATTAAGCCTAATTAATCCATTATTAGCGTATGTGGGTTGCATGTAGCACTTATGGCTAATCATAGACTAATTAGGCACAAAAGATT[C/A]
GTCTCGCGATTTCCAAACTGTGCAGTTAGTTTTTCACTTTATCTATATTTAATGCTTCATACATATATTCAAAGATTCGATGTGATGTTTTTGGGAAAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.80% | 0.10% | 0.89% | 21.12% | NA |
| All Indica | 2759 | 99.00% | 0.00% | 0.04% | 0.94% | NA |
| All Japonica | 1512 | 39.60% | 0.50% | 2.58% | 57.41% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.37% | 0.37% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.00% | 0.17% | NA |
| Indica II | 465 | 99.60% | 0.00% | 0.00% | 0.43% | NA |
| Indica III | 913 | 98.90% | 0.00% | 0.00% | 1.10% | NA |
| Indica Intermediate | 786 | 98.20% | 0.00% | 0.13% | 1.65% | NA |
| Temperate Japonica | 767 | 56.80% | 0.10% | 3.26% | 39.77% | NA |
| Tropical Japonica | 504 | 24.40% | 0.60% | 1.79% | 73.21% | NA |
| Japonica Intermediate | 241 | 16.20% | 1.20% | 2.07% | 80.50% | NA |
| VI/Aromatic | 96 | 19.80% | 0.00% | 1.04% | 79.17% | NA |
| Intermediate | 90 | 70.00% | 0.00% | 0.00% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0221843984 | G -> T | LOC_Os02g36210.1 | intron_variant ; MODIFIER | silent_mutation | Average:31.536; most accessible tissue: Callus, score: 68.1 | N | N | N | N |
| vg0221843984 | G -> DEL | N | N | silent_mutation | Average:31.536; most accessible tissue: Callus, score: 68.1 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0221843984 | 2.06E-06 | NA | mr1210 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221843984 | 1.75E-07 | 1.75E-07 | mr1186_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221843984 | 5.71E-06 | 5.71E-06 | mr1245_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221843984 | 2.97E-07 | NA | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221843984 | NA | 4.49E-06 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221843984 | NA | 2.85E-11 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221843984 | NA | 5.52E-08 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221843984 | 2.70E-06 | 2.33E-10 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221843984 | NA | 1.71E-06 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221843984 | 4.31E-07 | NA | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221843984 | 5.01E-06 | NA | mr1647_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221843984 | 2.17E-07 | 2.17E-07 | mr1647_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221843984 | 7.40E-06 | 7.40E-06 | mr1655_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221843984 | NA | 6.05E-07 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221843984 | 4.82E-07 | 2.87E-13 | mr1947_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221843984 | NA | 1.68E-06 | mr1977_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |