\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221838070:

Variant ID: vg0221838070 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21838070
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.70, T: 0.30, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


CCAAGGTCTGATACCTAGGTACCAGCTGGTACCCAAGGTATCAGGTACCAGCCAGAACACTCATAGGTACTCCCTCCGTCCCAAAATAAGTGTAGTTTTA[T/C]
ACTATTCACGTTCAACGTTTGACCGTTCGTCTTATTTGAAAATTTTTTATGATTAGTATTTTTATTGCTATTAGATGATAAAACATGAATAGTACTTTAT

Reverse complement sequence

ATAAAGTACTATTCATGTTTTATCATCTAATAGCAATAAAAATACTAATCATAAAAAATTTTCAAATAAGACGAACGGTCAAACGTTGAACGTGAATAGT[A/G]
TAAAACTACACTTATTTTGGGACGGAGGGAGTACCTATGAGTGTTCTGGCTGGTACCTGATACCTTGGGTACCAGCTGGTACCTAGGTATCAGACCTTGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.70% 46.60% 0.68% 0.02% NA
All Indica  2759 68.20% 30.80% 0.87% 0.04% NA
All Japonica  1512 34.30% 65.30% 0.40% 0.00% NA
Aus  269 17.10% 82.90% 0.00% 0.00% NA
Indica I  595 71.40% 27.60% 0.84% 0.17% NA
Indica II  465 64.90% 34.20% 0.86% 0.00% NA
Indica III  913 73.60% 25.80% 0.55% 0.00% NA
Indica Intermediate  786 61.60% 37.20% 1.27% 0.00% NA
Temperate Japonica  767 62.30% 37.00% 0.65% 0.00% NA
Tropical Japonica  504 3.60% 96.20% 0.20% 0.00% NA
Japonica Intermediate  241 9.50% 90.50% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 46.70% 51.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221838070 T -> DEL N N silent_mutation Average:50.843; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0221838070 T -> C LOC_Os02g36210.1 upstream_gene_variant ; 2989.0bp to feature; MODIFIER silent_mutation Average:50.843; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0221838070 T -> C LOC_Os02g36200-LOC_Os02g36210 intergenic_region ; MODIFIER silent_mutation Average:50.843; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221838070 NA 2.08E-09 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221838070 NA 3.04E-08 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221838070 NA 1.61E-08 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221838070 NA 2.51E-06 mr1284_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221838070 2.27E-06 2.27E-06 mr1311_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221838070 NA 8.36E-07 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221838070 NA 9.87E-06 mr1373_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221838070 3.77E-06 1.99E-07 mr1374_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221838070 7.36E-06 2.32E-07 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221838070 NA 2.31E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221838070 8.24E-06 NA mr1663_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221838070 2.29E-06 2.30E-06 mr1674_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221838070 NA 3.53E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221838070 NA 8.10E-06 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221838070 5.08E-06 5.06E-06 mr1760_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221838070 NA 4.53E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221838070 NA 5.56E-06 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221838070 NA 3.33E-10 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221838070 NA 3.46E-13 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221838070 NA 4.68E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251