\
| Variant ID: vg0221812870 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 21812870 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GCGCGTCCAGGAACTCGTCGCGGTGGCTGCACCGGCCGCCGACGGAGCTCACCATCACGATGTCGTTGGCGAGCTTGCTGATCCTCTCGTTGAGGTTCAC[G/A]
CCAGCGTCGCCGCCCGCGCCCGCGTCGGCGGCCAGCTCACGCACGAGCCGCGCCACCTCGCGCTCTCGGACGCCCTGGAACGACCTCACCCGGGCGGCGG
CCGCCGCCCGGGTGAGGTCGTTCCAGGGCGTCCGAGAGCGCGAGGTGGCGCGGCTCGTGCGTGAGCTGGCCGCCGACGCGGGCGCGGGCGGCGACGCTGG[C/T]
GTGAACCTCAACGAGAGGATCAGCAAGCTCGCCAACGACATCGTGATGGTGAGCTCCGTCGGCGGCCGGTGCAGCCACCGCGACGAGTTCCTGGACGCGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.10% | 5.70% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 81.90% | 17.40% | 0.73% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 92.80% | 6.10% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 69.20% | 30.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 73.40% | 25.70% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 4.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0221812870 | G -> A | LOC_Os02g36190.1 | synonymous_variant ; p.Gly174Gly; LOW | synonymous_codon | Average:56.009; most accessible tissue: Zhenshan97 flag leaf, score: 85.388 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0221812870 | NA | 5.72E-07 | mr1502 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221812870 | NA | 4.20E-06 | mr1502 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221812870 | 1.07E-09 | 1.38E-11 | mr1543 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221812870 | 6.33E-07 | 4.51E-11 | mr1543 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221812870 | 3.52E-06 | NA | mr1745 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221812870 | 1.30E-22 | 5.28E-35 | mr1871 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221812870 | 4.87E-09 | 4.91E-17 | mr1871 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221812870 | 1.32E-24 | 6.32E-43 | mr1042_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221812870 | 5.16E-14 | 2.49E-19 | mr1042_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221812870 | 8.07E-08 | 3.05E-12 | mr1502_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221812870 | NA | 5.55E-09 | mr1502_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221812870 | 4.81E-14 | 1.06E-17 | mr1543_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221812870 | 1.90E-09 | 4.96E-14 | mr1543_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221812870 | 5.83E-12 | 2.94E-19 | mr1680_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221812870 | 1.06E-07 | 1.55E-10 | mr1680_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221812870 | 8.73E-16 | 1.04E-25 | mr1742_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221812870 | 8.51E-10 | 4.86E-15 | mr1742_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221812870 | 3.34E-09 | NA | mr1745_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221812870 | 2.99E-45 | 4.72E-67 | mr1871_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221812870 | 1.49E-20 | 1.49E-30 | mr1871_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |