Search for Variation information by Variation ID:
Detailed information for vg0221797930:
| Variant ID: vg0221797930 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 21797930 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
AGGTTCTGACATAGTCGAACGAGACGTAGAACCGGAACCATTTGAATGCTGAGATGCTTTCTGATAGTATTGTGCTGGCGAGTTGGTTTTTCGACACAAA[C/T]
CTTCTTTTGCTCGAATCTCTAGGGACATTACTCTGCGTCTCTTGTACTCTTGCATCTCTTGTTCTGCATCTTCTAGTAACAAGGACTTATCGACCATTTG
Reverse complement sequence
CAAATGGTCGATAAGTCCTTGTTACTAGAAGATGCAGAACAAGAGATGCAAGAGTACAAGAGACGCAGAGTAATGTCCCTAGAGATTCGAGCAAAAGAAG[G/A]
TTTGTGTCGAAAAACCAACTCGCCAGCACAATACTATCAGAAAGCATCTCAGCATTCAAATGGTTCCGGTTCTACGTCTCGTTCGACTATGTCAGAACCT
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.90% | 0.10% | 3.49% | 18.49% | NA |
| All Indica | 2759 | 98.40% | 0.00% | 0.62% | 0.94% | NA |
| All Japonica | 1512 | 40.70% | 0.50% | 8.73% | 50.07% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.00% | 0.43% | 0.00% | NA |
| Indica III | 913 | 98.60% | 0.00% | 0.66% | 0.77% | NA |
| Indica Intermediate | 786 | 96.40% | 0.00% | 1.15% | 2.42% | NA |
| Temperate Japonica | 767 | 58.30% | 0.70% | 5.22% | 35.85% | NA |
| Tropical Japonica | 504 | 25.00% | 0.40% | 8.73% | 65.87% | NA |
| Japonica Intermediate | 241 | 17.80% | 0.00% | 19.92% | 62.24% | NA |
| VI/Aromatic | 96 | 19.80% | 0.00% | 12.50% | 67.71% | NA |
| Intermediate | 90 | 67.80% | 0.00% | 4.44% | 27.78% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0221797930 | C -> T | LOC_Os02g36170.1 | missense_variant ; p.Gly295Asp; MODERATE | nonsynonymous_codon ; G295D | Average:22.989; most accessible tissue: Callus, score: 32.834 | benign  |
0.232 |
TOLERATED | 0.32 |
| vg0221797930 | C -> DEL | LOC_Os02g36170.1 | N | frameshift_variant | Average:22.989; most accessible tissue: Callus, score: 32.834 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0221797930 | NA | 7.02E-06 | mr1502 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221797930 | 4.38E-06 | 4.45E-06 | mr1543 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221797930 | NA | 1.16E-07 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221797930 | NA | 3.11E-13 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221797930 | 2.57E-08 | 1.40E-22 | mr1042_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221797930 | 3.55E-06 | 1.81E-08 | mr1502_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221797930 | 4.74E-07 | NA | mr1543_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221797930 | NA | 9.84E-11 | mr1680_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221797930 | 1.10E-07 | 1.97E-13 | mr1742_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221797930 | 1.79E-09 | 1.86E-21 | mr1871_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |