Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221763837:

Variant ID: vg0221763837 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 21763837
Reference Allele: G	Alternative Allele: A,C
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATATTGCAAACTTTTCAATAAACTTGATCAAACAAAAATAAATTTGACAAAAAAAAGTCAAACGACTTATAATATGAAAAGAGAGTATGACTATGACAT[G/A,C]
CTAAACTCAATAAAACAAAGTTTATGTGAATTAGCATATCCAAGATGACACTTTAATTTTTATATGTACCACCAACTTAATTTGAAATTTGCAACCATGT

Reverse complement sequence

ACATGGTTGCAAATTTCAAATTAAGTTGGTGGTACATATAAAAATTAAAGTGTCATCTTGGATATGCTAATTCACATAAACTTTGTTTTATTGAGTTTAG[C/T,G]
ATGTCATAGTCATACTCTCTTTTCATATTATAAGTCGTTTGACTTTTTTTTGTCAAATTTATTTTTGTTTGATCAAGTTTATTGAAAAGTTTGCAATATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.20%	4.00%	0.74%	0.00%	C: 0.06%
All Indica	2759	92.00%	6.70%	1.23%	0.00%	C: 0.04%
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	98.50%	1.10%	0.37%	0.00%	NA
Indica I	595	98.30%	0.80%	0.84%	0.00%	NA
Indica II	465	77.40%	19.40%	3.23%	0.00%	NA
Indica III	913	97.80%	1.50%	0.66%	0.00%	NA
Indica Intermediate	786	89.20%	9.70%	1.02%	0.00%	C: 0.13%
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	3.30%	0.00%	0.00%	C: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221763837	G -> A	LOC_Os02g36140.2	upstream_gene_variant ; 1172.0bp to feature; MODIFIER	silent_mutation	Average:28.569; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0221763837	G -> A	LOC_Os02g36140.5	upstream_gene_variant ; 1172.0bp to feature; MODIFIER	silent_mutation	Average:28.569; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0221763837	G -> A	LOC_Os02g36140.4	upstream_gene_variant ; 1172.0bp to feature; MODIFIER	silent_mutation	Average:28.569; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0221763837	G -> A	LOC_Os02g36140.3	upstream_gene_variant ; 1172.0bp to feature; MODIFIER	silent_mutation	Average:28.569; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0221763837	G -> A	LOC_Os02g36130-LOC_Os02g36140	intergenic_region ; MODIFIER	silent_mutation	Average:28.569; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0221763837	G -> C	LOC_Os02g36140.2	upstream_gene_variant ; 1172.0bp to feature; MODIFIER	silent_mutation	Average:28.569; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0221763837	G -> C	LOC_Os02g36140.5	upstream_gene_variant ; 1172.0bp to feature; MODIFIER	silent_mutation	Average:28.569; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0221763837	G -> C	LOC_Os02g36140.4	upstream_gene_variant ; 1172.0bp to feature; MODIFIER	silent_mutation	Average:28.569; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0221763837	G -> C	LOC_Os02g36140.3	upstream_gene_variant ; 1172.0bp to feature; MODIFIER	silent_mutation	Average:28.569; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0221763837	G -> C	LOC_Os02g36130-LOC_Os02g36140	intergenic_region ; MODIFIER	silent_mutation	Average:28.569; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221763837	NA	9.65E-07	mr1098	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221763837	NA	3.65E-06	mr1099	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221763837	NA	4.82E-06	mr1101	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221763837	NA	5.06E-06	mr1150	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221763837	NA	2.35E-06	mr1224	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221763837	NA	4.93E-06	mr1225	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221763837	NA	1.32E-06	mr1399	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221763837	NA	1.93E-06	mr1425	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221763837	NA	1.69E-06	mr1589	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221763837	3.71E-06	3.71E-06	mr1847	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221763837	NA	7.57E-06	mr1911	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221763837	NA	9.02E-08	mr1918	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221763837	NA	4.13E-06	mr1929	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251