Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221740163:

Variant ID: vg0221740163 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 21740163
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

GAGAAATGGAAATAAACGCCATGCAGTAAGGGTATATTCTAAACTTCGGCTAAGTTTAGTTACAAACTATTTCTTTAAACTTCCAATTTTTCCATCACAT[C/T]
AAAACTTTTCTACACATAAACTTTCAACTTTTTCATCACATCGTTCCAATTTCAACTAAACTTTTAATTTTAACGTTAACTAAACCCACCCTTCAACTCG

Reverse complement sequence

CGAGTTGAAGGGTGGGTTTAGTTAACGTTAAAATTAAAAGTTTAGTTGAAATTGGAACGATGTGATGAAAAAGTTGAAAGTTTATGTGTAGAAAAGTTTT[G/A]
ATGTGATGGAAAAATTGGAAGTTTAAAGAAATAGTTTGTAACTAAACTTAGCCGAAGTTTAGAATATACCCTTACTGCATGGCGTTTATTTCCATTTCTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.50%	5.40%	0.08%	0.00%	NA
All Indica	2759	90.80%	9.00%	0.14%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.30%	0.50%	0.17%	0.00%	NA
Indica II	465	75.50%	24.30%	0.22%	0.00%	NA
Indica III	913	94.60%	5.40%	0.00%	0.00%	NA
Indica Intermediate	786	89.10%	10.70%	0.25%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221740163	C -> T	LOC_Os02g36110.1	upstream_gene_variant ; 141.0bp to feature; MODIFIER	silent_mutation	Average:60.493; most accessible tissue: Minghui63 root, score: 84.447	N	N	N	N
vg0221740163	C -> T	LOC_Os02g36120.1	downstream_gene_variant ; 2696.0bp to feature; MODIFIER	silent_mutation	Average:60.493; most accessible tissue: Minghui63 root, score: 84.447	N	N	N	N
vg0221740163	C -> T	LOC_Os02g36100-LOC_Os02g36110	intergenic_region ; MODIFIER	silent_mutation	Average:60.493; most accessible tissue: Minghui63 root, score: 84.447	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221740163	NA	4.63E-08	mr1074	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221740163	NA	1.78E-08	mr1098	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221740163	8.67E-06	4.39E-07	mr1099	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221740163	NA	7.91E-07	mr1101	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221740163	9.46E-06	NA	mr1146	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221740163	NA	2.35E-07	mr1150	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221740163	NA	3.86E-07	mr1197	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221740163	NA	1.70E-06	mr1224	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221740163	NA	1.72E-06	mr1399	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221740163	NA	7.78E-07	mr1425	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221740163	NA	4.12E-08	mr1589	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221740163	NA	4.07E-06	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221740163	NA	4.34E-06	mr1858	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221740163	NA	4.26E-06	mr1859	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221740163	1.31E-06	1.31E-06	mr1863	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221740163	2.99E-06	8.51E-07	mr1868	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221740163	NA	1.21E-07	mr1877	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221740163	NA	1.19E-06	mr1911	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221740163	NA	2.81E-10	mr1918	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221740163	2.98E-06	2.74E-11	mr1929	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221740163	NA	4.94E-08	mr1929	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221740163	NA	1.36E-06	mr1150_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251