\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221717035:

Variant ID: vg0221717035 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21717035
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


AGGTGGAGAATATACTACTACAAAAGTTAAAAGTTGATAGGTGGGCAATAAAATATTATCTTGTGATCACCAAATTCCTTATATTTTAGAATAAAACAAG[T/C]
AGGACAAAATTAACTATATTATGGGACATGGGAATATCATATACTCCCTCTCCATTGATCCATTCAATAAATCAAATCTTAGAGTTAAAAAATATCCCAA

Reverse complement sequence

TTGGGATATTTTTTAACTCTAAGATTTGATTTATTGAATGGATCAATGGAGAGGGAGTATATGATATTCCCATGTCCCATAATATAGTTAATTTTGTCCT[A/G]
CTTGTTTTATTCTAAAATATAAGGAATTTGGTGATCACAAGATAATATTTTATTGCCCACCTATCAACTTTTAACTTTTGTAGTAGTATATTCTCCACCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.70% 3.00% 3.32% 0.00% NA
All Indica  2759 89.30% 5.10% 5.55% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 74.60% 10.90% 14.45% 0.00% NA
Indica II  465 87.50% 9.00% 3.44% 0.00% NA
Indica III  913 99.10% 0.00% 0.88% 0.00% NA
Indica Intermediate  786 90.20% 4.30% 5.47% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 2.20% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221717035 T -> C LOC_Os02g36090.1 upstream_gene_variant ; 323.0bp to feature; MODIFIER silent_mutation Average:29.328; most accessible tissue: Callus, score: 67.834 N N N N
vg0221717035 T -> C LOC_Os02g36090-LOC_Os02g36100 intergenic_region ; MODIFIER silent_mutation Average:29.328; most accessible tissue: Callus, score: 67.834 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221717035 5.23E-06 2.63E-10 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221717035 NA 1.42E-10 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221717035 1.04E-07 4.89E-07 mr1057 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221717035 NA 5.38E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221717035 NA 6.88E-06 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221717035 4.34E-06 3.83E-12 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221717035 NA 3.50E-11 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221717035 NA 1.87E-10 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221717035 NA 1.44E-08 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221717035 NA 2.34E-08 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221717035 NA 1.15E-08 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221717035 NA 4.64E-08 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251