\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221694296:

Variant ID: vg0221694296 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21694296
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAAAACACTATCACATCGTGGCTGGCTTAGCAAAACAATATTGTCACGTCTGTTTGAATAGCATGACCTCGTTATTTGCTCAAGTCGGTCTAACTAGC[A/G]
TGATAACGTTGTCTGTCACGTCACCCTGAATAGTGTAGTAAGACAAAACGGTCACGCCCATTGCGGATGGCGTGACATCGTTATTTTGTTATGCCAGACG

Reverse complement sequence

CGTCTGGCATAACAAAATAACGATGTCACGCCATCCGCAATGGGCGTGACCGTTTTGTCTTACTACACTATTCAGGGTGACGTGACAGACAACGTTATCA[T/C]
GCTAGTTAGACCGACTTGAGCAAATAACGAGGTCATGCTATTCAAACAGACGTGACAATATTGTTTTGCTAAGCCAGCCACGATGTGATAGTGTTTTTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.00% 27.50% 0.53% 0.00% NA
All Indica  2759 97.70% 2.10% 0.22% 0.00% NA
All Japonica  1512 25.20% 73.50% 1.26% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.20% 0.30% 0.50% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 98.50% 1.50% 0.00% 0.00% NA
Indica Intermediate  786 94.80% 4.80% 0.38% 0.00% NA
Temperate Japonica  767 32.70% 64.90% 2.35% 0.00% NA
Tropical Japonica  504 16.30% 83.70% 0.00% 0.00% NA
Japonica Intermediate  241 19.90% 79.70% 0.41% 0.00% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 52.20% 47.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221694296 A -> G LOC_Os02g36070.1 downstream_gene_variant ; 2110.0bp to feature; MODIFIER silent_mutation Average:46.921; most accessible tissue: Callus, score: 96.785 N N N N
vg0221694296 A -> G LOC_Os02g36070-LOC_Os02g36080 intergenic_region ; MODIFIER silent_mutation Average:46.921; most accessible tissue: Callus, score: 96.785 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221694296 NA 3.31E-09 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221694296 NA 1.26E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221694296 NA 1.05E-12 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221694296 NA 8.96E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221694296 NA 2.44E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221694296 NA 1.15E-12 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221694296 NA 3.27E-08 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221694296 NA 5.86E-20 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221694296 NA 1.75E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221694296 NA 3.70E-19 mr1767 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221694296 NA 3.29E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221694296 NA 6.00E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221694296 NA 2.48E-14 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221694296 1.59E-06 1.12E-14 mr1921 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221694296 NA 2.44E-07 mr1921 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221694296 NA 6.00E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221694296 NA 6.78E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251