\
| Variant ID: vg0221694296 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 21694296 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAAAAAACACTATCACATCGTGGCTGGCTTAGCAAAACAATATTGTCACGTCTGTTTGAATAGCATGACCTCGTTATTTGCTCAAGTCGGTCTAACTAGC[A/G]
TGATAACGTTGTCTGTCACGTCACCCTGAATAGTGTAGTAAGACAAAACGGTCACGCCCATTGCGGATGGCGTGACATCGTTATTTTGTTATGCCAGACG
CGTCTGGCATAACAAAATAACGATGTCACGCCATCCGCAATGGGCGTGACCGTTTTGTCTTACTACACTATTCAGGGTGACGTGACAGACAACGTTATCA[T/C]
GCTAGTTAGACCGACTTGAGCAAATAACGAGGTCATGCTATTCAAACAGACGTGACAATATTGTTTTGCTAAGCCAGCCACGATGTGATAGTGTTTTTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.00% | 27.50% | 0.53% | 0.00% | NA |
| All Indica | 2759 | 97.70% | 2.10% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 25.20% | 73.50% | 1.26% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.30% | 0.50% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.80% | 4.80% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 32.70% | 64.90% | 2.35% | 0.00% | NA |
| Tropical Japonica | 504 | 16.30% | 83.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 19.90% | 79.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 47.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0221694296 | A -> G | LOC_Os02g36070.1 | downstream_gene_variant ; 2110.0bp to feature; MODIFIER | silent_mutation | Average:46.921; most accessible tissue: Callus, score: 96.785 | N | N | N | N |
| vg0221694296 | A -> G | LOC_Os02g36070-LOC_Os02g36080 | intergenic_region ; MODIFIER | silent_mutation | Average:46.921; most accessible tissue: Callus, score: 96.785 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0221694296 | NA | 3.31E-09 | mr1097 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221694296 | NA | 1.26E-10 | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221694296 | NA | 1.05E-12 | mr1205 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221694296 | NA | 8.96E-13 | mr1239 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221694296 | NA | 2.44E-08 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221694296 | NA | 1.15E-12 | mr1521 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221694296 | NA | 3.27E-08 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221694296 | NA | 5.86E-20 | mr1627 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221694296 | NA | 1.75E-11 | mr1683 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221694296 | NA | 3.70E-19 | mr1767 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221694296 | NA | 3.29E-07 | mr1810 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221694296 | NA | 6.00E-07 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221694296 | NA | 2.48E-14 | mr1909 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221694296 | 1.59E-06 | 1.12E-14 | mr1921 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221694296 | NA | 2.44E-07 | mr1921 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221694296 | NA | 6.00E-06 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221694296 | NA | 6.78E-07 | mr1548_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |