Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221682664:

Variant ID: vg0221682664 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 21682664
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGCATGGACATGAAATTTAATTTGTCTGCATCACGTGTTGAATAGTCTTCGCCGGAAAGTAGAACTGCATGCATTTTTGCTACGTGGTCCATTCATGTGC[G/A]
ACGATCATTGATAAATATGAGTAAATATAATACTTTCGACTATATATATTATAGTTTCACTTTAGAGCACTCTTTAAGTTTTTTTTTTAAAAAAAATTGA

Reverse complement sequence

TCAATTTTTTTTAAAAAAAAAACTTAAAGAGTGCTCTAAAGTGAAACTATAATATATATAGTCGAAAGTATTATATTTACTCATATTTATCAATGATCGT[C/T]
GCACATGAATGGACCACGTAGCAAAAATGCATGCAGTTCTACTTTCCGGCGAAGACTATTCAACACGTGATGCAGACAAATTAAATTTCATGTCCATGCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.50%	34.40%	0.15%	0.00%	NA
All Indica	2759	97.20%	2.60%	0.22%	0.00%	NA
All Japonica	1512	6.20%	93.80%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	97.10%	2.40%	0.50%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	98.50%	1.50%	0.00%	0.00%	NA
Indica Intermediate	786	94.70%	5.00%	0.38%	0.00%	NA
Temperate Japonica	767	1.30%	98.70%	0.00%	0.00%	NA
Tropical Japonica	504	13.90%	86.10%	0.00%	0.00%	NA
Japonica Intermediate	241	5.40%	94.60%	0.00%	0.00%	NA
VI/Aromatic	96	11.50%	88.50%	0.00%	0.00%	NA
Intermediate	90	45.60%	53.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221682664	G -> A	LOC_Os02g36060.1	upstream_gene_variant ; 2382.0bp to feature; MODIFIER	silent_mutation	Average:52.21; most accessible tissue: Callus, score: 79.242	N	N	N	N
vg0221682664	G -> A	LOC_Os02g36060-LOC_Os02g36070	intergenic_region ; MODIFIER	silent_mutation	Average:52.21; most accessible tissue: Callus, score: 79.242	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221682664	NA	2.14E-66	mr1027	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221682664	NA	2.45E-31	mr1074	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221682664	NA	1.84E-10	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221682664	3.74E-07	2.25E-47	mr1136	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221682664	NA	5.75E-14	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221682664	NA	2.31E-81	mr1672	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221682664	NA	6.90E-35	mr1682	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221682664	NA	3.67E-10	mr1714	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221682664	NA	5.86E-19	mr1754	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221682664	NA	3.29E-18	mr1767	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221682664	NA	1.93E-54	mr1136_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221682664	NA	5.87E-10	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221682664	NA	1.72E-08	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221682664	NA	1.78E-06	mr1691_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221682664	NA	8.46E-23	mr1708_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251