Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221672771:

Variant ID: vg0221672771 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 21672771
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTAGAATTGGCCTTTGCAACATGTGTTTAATAACATCGGCTTGACAAGTAACTATGCATGTACTAGATAACAAATAATGCCTCAACTTGGTACAAGCATA[G/A]
TATAAGCATAGACAAAGCCTCTCTATAAAAACATACCTCGTTTCGGCATCCAAAAGACGGCGGCTCAAAAAGGTAATGATATATTCCTTGCCATCTTCCT

Reverse complement sequence

AGGAAGATGGCAAGGAATATATCATTACCTTTTTGAGCCGCCGTCTTTTGGATGCCGAAACGAGGTATGTTTTTATAGAGAGGCTTTGTCTATGCTTATA[C/T]
TATGCTTGTACCAAGTTGAGGCATTATTTGTTATCTAGTACATGCATAGTTACTTGTCAAGCCGATGTTATTAAACACATGTTGCAAAGGCCAATTCTAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.20%	5.20%	21.29%	28.35%	NA
All Indica	2759	19.70%	1.50%	34.00%	44.76%	NA
All Japonica	1512	94.60%	0.20%	1.46%	3.77%	NA
Aus	269	5.20%	72.50%	11.15%	11.15%	NA
Indica I	595	28.90%	0.30%	28.91%	41.85%	NA
Indica II	465	20.90%	1.30%	22.15%	55.70%	NA
Indica III	913	11.30%	1.10%	46.77%	40.85%	NA
Indica Intermediate	786	21.90%	3.10%	30.03%	45.04%	NA
Temperate Japonica	767	98.80%	0.10%	0.52%	0.52%	NA
Tropical Japonica	504	87.90%	0.20%	3.17%	8.73%	NA
Japonica Intermediate	241	95.00%	0.40%	0.83%	3.73%	NA
VI/Aromatic	96	90.60%	4.20%	4.17%	1.04%	NA
Intermediate	90	65.60%	2.20%	13.33%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221672771	G -> A	LOC_Os02g36040.1	downstream_gene_variant ; 4975.0bp to feature; MODIFIER	silent_mutation	Average:12.286; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg0221672771	G -> A	LOC_Os02g36060.1	downstream_gene_variant ; 3572.0bp to feature; MODIFIER	silent_mutation	Average:12.286; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg0221672771	G -> A	LOC_Os02g36050.1	intron_variant ; MODIFIER	silent_mutation	Average:12.286; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg0221672771	G -> DEL	N	N	silent_mutation	Average:12.286; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221672771	NA	3.01E-15	mr1113	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771	NA	2.40E-18	mr1114	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771	NA	9.16E-21	mr1117	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771	NA	6.88E-17	mr1119	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771	NA	5.68E-22	mr1120	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771	NA	1.04E-22	mr1123	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771	NA	2.06E-25	mr1247	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771	NA	1.42E-06	mr1735	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771	NA	2.87E-26	mr1858	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771	NA	2.63E-26	mr1859	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771	NA	4.86E-20	mr1936	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771	NA	2.11E-19	mr1961	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771	NA	4.17E-31	mr1098_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771	NA	2.00E-19	mr1113_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771	NA	3.60E-18	mr1114_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771	NA	4.11E-21	mr1117_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771	NA	5.90E-21	mr1119_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771	NA	9.75E-25	mr1120_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771	NA	3.32E-24	mr1123_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771	NA	6.25E-19	mr1240_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771	4.43E-08	8.52E-25	mr1244_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771	NA	2.83E-28	mr1247_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771	NA	2.69E-17	mr1936_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771	NA	1.81E-15	mr1961_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251