\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221672771:

Variant ID: vg0221672771 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21672771
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAGAATTGGCCTTTGCAACATGTGTTTAATAACATCGGCTTGACAAGTAACTATGCATGTACTAGATAACAAATAATGCCTCAACTTGGTACAAGCATA[G/A]
TATAAGCATAGACAAAGCCTCTCTATAAAAACATACCTCGTTTCGGCATCCAAAAGACGGCGGCTCAAAAAGGTAATGATATATTCCTTGCCATCTTCCT

Reverse complement sequence

AGGAAGATGGCAAGGAATATATCATTACCTTTTTGAGCCGCCGTCTTTTGGATGCCGAAACGAGGTATGTTTTTATAGAGAGGCTTTGTCTATGCTTATA[C/T]
TATGCTTGTACCAAGTTGAGGCATTATTTGTTATCTAGTACATGCATAGTTACTTGTCAAGCCGATGTTATTAAACACATGTTGCAAAGGCCAATTCTAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.20% 5.20% 21.29% 28.35% NA
All Indica  2759 19.70% 1.50% 34.00% 44.76% NA
All Japonica  1512 94.60% 0.20% 1.46% 3.77% NA
Aus  269 5.20% 72.50% 11.15% 11.15% NA
Indica I  595 28.90% 0.30% 28.91% 41.85% NA
Indica II  465 20.90% 1.30% 22.15% 55.70% NA
Indica III  913 11.30% 1.10% 46.77% 40.85% NA
Indica Intermediate  786 21.90% 3.10% 30.03% 45.04% NA
Temperate Japonica  767 98.80% 0.10% 0.52% 0.52% NA
Tropical Japonica  504 87.90% 0.20% 3.17% 8.73% NA
Japonica Intermediate  241 95.00% 0.40% 0.83% 3.73% NA
VI/Aromatic  96 90.60% 4.20% 4.17% 1.04% NA
Intermediate  90 65.60% 2.20% 13.33% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221672771 G -> A LOC_Os02g36040.1 downstream_gene_variant ; 4975.0bp to feature; MODIFIER silent_mutation Average:12.286; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0221672771 G -> A LOC_Os02g36060.1 downstream_gene_variant ; 3572.0bp to feature; MODIFIER silent_mutation Average:12.286; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0221672771 G -> A LOC_Os02g36050.1 intron_variant ; MODIFIER silent_mutation Average:12.286; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0221672771 G -> DEL N N silent_mutation Average:12.286; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221672771 NA 3.01E-15 mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771 NA 2.40E-18 mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771 NA 9.16E-21 mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771 NA 6.88E-17 mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771 NA 5.68E-22 mr1120 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771 NA 1.04E-22 mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771 NA 2.06E-25 mr1247 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771 NA 1.42E-06 mr1735 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771 NA 2.87E-26 mr1858 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771 NA 2.63E-26 mr1859 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771 NA 4.86E-20 mr1936 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771 NA 2.11E-19 mr1961 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771 NA 4.17E-31 mr1098_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771 NA 2.00E-19 mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771 NA 3.60E-18 mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771 NA 4.11E-21 mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771 NA 5.90E-21 mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771 NA 9.75E-25 mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771 NA 3.32E-24 mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771 NA 6.25E-19 mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771 4.43E-08 8.52E-25 mr1244_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771 NA 2.83E-28 mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771 NA 2.69E-17 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221672771 NA 1.81E-15 mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251