\
| Variant ID: vg0221622425 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 21622425 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TAATTGACTGTAACTCTCTAAGCAAAAGCCATGATTATATTTCATTATATAAAAAAAAAACTGGCGTATCTCTTTACATGCATGATGAGACTTCTAAGCG[C/T]
CGTCCCTCTCGTCGTTTTCTTGACCGGATGAATCTCCTCTCTTGACTTTGACCTGTCAAGAGGTTAGTTGACTTGAAATCAAATACAATATGTTTCTCTA
TAGAGAAACATATTGTATTTGATTTCAAGTCAACTAACCTCTTGACAGGTCAAAGTCAAGAGAGGAGATTCATCCGGTCAAGAAAACGACGAGAGGGACG[G/A]
CGCTTAGAAGTCTCATCATGCATGTAAAGAGATACGCCAGTTTTTTTTTTATATAATGAAATATAATCATGGCTTTTGCTTAGAGAGTTACAGTCAATTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.30% | 4.00% | 2.62% | 0.00% | NA |
| All Indica | 2759 | 89.20% | 6.40% | 4.35% | 0.00% | NA |
| All Japonica | 1512 | 99.30% | 0.40% | 0.26% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 76.10% | 10.80% | 13.11% | 0.00% | NA |
| Indica II | 465 | 84.90% | 12.90% | 2.15% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.00% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 89.70% | 6.70% | 3.56% | 0.00% | NA |
| Temperate Japonica | 767 | 99.10% | 0.70% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.40% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0221622425 | C -> T | LOC_Os02g36000.1 | upstream_gene_variant ; 2597.0bp to feature; MODIFIER | silent_mutation | Average:58.163; most accessible tissue: Callus, score: 92.859 | N | N | N | N |
| vg0221622425 | C -> T | LOC_Os02g35980.1 | downstream_gene_variant ; 3654.0bp to feature; MODIFIER | silent_mutation | Average:58.163; most accessible tissue: Callus, score: 92.859 | N | N | N | N |
| vg0221622425 | C -> T | LOC_Os02g35980-LOC_Os02g36000 | intergenic_region ; MODIFIER | silent_mutation | Average:58.163; most accessible tissue: Callus, score: 92.859 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0221622425 | NA | 1.15E-06 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221622425 | NA | 1.57E-07 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221622425 | NA | 1.25E-08 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221622425 | NA | 1.01E-08 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221622425 | NA | 4.19E-07 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221622425 | NA | 1.04E-07 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221622425 | NA | 7.34E-06 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221622425 | NA | 8.23E-07 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221622425 | 3.82E-07 | 3.82E-07 | mr1416_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |