\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221622425:

Variant ID: vg0221622425 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21622425
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAATTGACTGTAACTCTCTAAGCAAAAGCCATGATTATATTTCATTATATAAAAAAAAAACTGGCGTATCTCTTTACATGCATGATGAGACTTCTAAGCG[C/T]
CGTCCCTCTCGTCGTTTTCTTGACCGGATGAATCTCCTCTCTTGACTTTGACCTGTCAAGAGGTTAGTTGACTTGAAATCAAATACAATATGTTTCTCTA

Reverse complement sequence

TAGAGAAACATATTGTATTTGATTTCAAGTCAACTAACCTCTTGACAGGTCAAAGTCAAGAGAGGAGATTCATCCGGTCAAGAAAACGACGAGAGGGACG[G/A]
CGCTTAGAAGTCTCATCATGCATGTAAAGAGATACGCCAGTTTTTTTTTTATATAATGAAATATAATCATGGCTTTTGCTTAGAGAGTTACAGTCAATTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.30% 4.00% 2.62% 0.00% NA
All Indica  2759 89.20% 6.40% 4.35% 0.00% NA
All Japonica  1512 99.30% 0.40% 0.26% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 76.10% 10.80% 13.11% 0.00% NA
Indica II  465 84.90% 12.90% 2.15% 0.00% NA
Indica III  913 99.60% 0.00% 0.44% 0.00% NA
Indica Intermediate  786 89.70% 6.70% 3.56% 0.00% NA
Temperate Japonica  767 99.10% 0.70% 0.26% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 0.40% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221622425 C -> T LOC_Os02g36000.1 upstream_gene_variant ; 2597.0bp to feature; MODIFIER silent_mutation Average:58.163; most accessible tissue: Callus, score: 92.859 N N N N
vg0221622425 C -> T LOC_Os02g35980.1 downstream_gene_variant ; 3654.0bp to feature; MODIFIER silent_mutation Average:58.163; most accessible tissue: Callus, score: 92.859 N N N N
vg0221622425 C -> T LOC_Os02g35980-LOC_Os02g36000 intergenic_region ; MODIFIER silent_mutation Average:58.163; most accessible tissue: Callus, score: 92.859 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221622425 NA 1.15E-06 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221622425 NA 1.57E-07 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221622425 NA 1.25E-08 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221622425 NA 1.01E-08 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221622425 NA 4.19E-07 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221622425 NA 1.04E-07 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221622425 NA 7.34E-06 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221622425 NA 8.23E-07 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221622425 3.82E-07 3.82E-07 mr1416_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251