\
| Variant ID: vg0221514962 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 21514962 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 93. )
TAAAAATAGAGTAAATTGCATCCACGGTGCATCAACTTGGCAGGTGGGTGCAATTTGGTGCAATATCTTGAAAAATGAGCATTCTAATACACGAACTTGG[C/T]
AGGTAGGTGCAATTTAGTATAAGAACTTTATAAGTGATCATATAAATGCAACAACTTGCATGGTAGGTACGATTTTGATAAAGTAAATTTAAGAGTTATG
CATAACTCTTAAATTTACTTTATCAAAATCGTACCTACCATGCAAGTTGTTGCATTTATATGATCACTTATAAAGTTCTTATACTAAATTGCACCTACCT[G/A]
CCAAGTTCGTGTATTAGAATGCTCATTTTTCAAGATATTGCACCAAATTGCACCCACCTGCCAAGTTGATGCACCGTGGATGCAATTTACTCTATTTTTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.90% | 4.00% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 48.30% | 51.30% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0221514962 | C -> T | LOC_Os02g35810.1 | upstream_gene_variant ; 1324.0bp to feature; MODIFIER | silent_mutation | Average:30.444; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0221514962 | C -> T | LOC_Os02g35820.1 | upstream_gene_variant ; 3805.0bp to feature; MODIFIER | silent_mutation | Average:30.444; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0221514962 | C -> T | LOC_Os02g35820.2 | upstream_gene_variant ; 3805.0bp to feature; MODIFIER | silent_mutation | Average:30.444; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0221514962 | C -> T | LOC_Os02g35800.1 | downstream_gene_variant ; 3670.0bp to feature; MODIFIER | silent_mutation | Average:30.444; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0221514962 | C -> T | LOC_Os02g35810-LOC_Os02g35820 | intergenic_region ; MODIFIER | silent_mutation | Average:30.444; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0221514962 | NA | 2.97E-07 | mr1530 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221514962 | NA | 1.57E-11 | mr1612 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221514962 | NA | 1.61E-18 | mr1855 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221514962 | NA | 3.32E-09 | mr1166_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221514962 | 6.00E-06 | NA | mr1248_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221514962 | 4.60E-07 | NA | mr1263_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221514962 | NA | 2.83E-06 | mr1608_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221514962 | NA | 2.52E-10 | mr1897_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |