\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221514962:

Variant ID: vg0221514962 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21514962
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


TAAAAATAGAGTAAATTGCATCCACGGTGCATCAACTTGGCAGGTGGGTGCAATTTGGTGCAATATCTTGAAAAATGAGCATTCTAATACACGAACTTGG[C/T]
AGGTAGGTGCAATTTAGTATAAGAACTTTATAAGTGATCATATAAATGCAACAACTTGCATGGTAGGTACGATTTTGATAAAGTAAATTTAAGAGTTATG

Reverse complement sequence

CATAACTCTTAAATTTACTTTATCAAAATCGTACCTACCATGCAAGTTGTTGCATTTATATGATCACTTATAAAGTTCTTATACTAAATTGCACCTACCT[G/A]
CCAAGTTCGTGTATTAGAATGCTCATTTTTCAAGATATTGCACCAAATTGCACCCACCTGCCAAGTTGATGCACCGTGGATGCAATTTACTCTATTTTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.90% 4.00% 0.02% 0.00% NA
All Indica  2759 98.20% 1.80% 0.00% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 48.30% 51.30% 0.37% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 96.90% 3.10% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221514962 C -> T LOC_Os02g35810.1 upstream_gene_variant ; 1324.0bp to feature; MODIFIER silent_mutation Average:30.444; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0221514962 C -> T LOC_Os02g35820.1 upstream_gene_variant ; 3805.0bp to feature; MODIFIER silent_mutation Average:30.444; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0221514962 C -> T LOC_Os02g35820.2 upstream_gene_variant ; 3805.0bp to feature; MODIFIER silent_mutation Average:30.444; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0221514962 C -> T LOC_Os02g35800.1 downstream_gene_variant ; 3670.0bp to feature; MODIFIER silent_mutation Average:30.444; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0221514962 C -> T LOC_Os02g35810-LOC_Os02g35820 intergenic_region ; MODIFIER silent_mutation Average:30.444; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221514962 NA 2.97E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221514962 NA 1.57E-11 mr1612 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221514962 NA 1.61E-18 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221514962 NA 3.32E-09 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221514962 6.00E-06 NA mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221514962 4.60E-07 NA mr1263_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221514962 NA 2.83E-06 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221514962 NA 2.52E-10 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251