Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0221514962:

Variant ID: vg0221514962 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 21514962
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

TAAAAATAGAGTAAATTGCATCCACGGTGCATCAACTTGGCAGGTGGGTGCAATTTGGTGCAATATCTTGAAAAATGAGCATTCTAATACACGAACTTGG[C/T]
AGGTAGGTGCAATTTAGTATAAGAACTTTATAAGTGATCATATAAATGCAACAACTTGCATGGTAGGTACGATTTTGATAAAGTAAATTTAAGAGTTATG

Reverse complement sequence

CATAACTCTTAAATTTACTTTATCAAAATCGTACCTACCATGCAAGTTGTTGCATTTATATGATCACTTATAAAGTTCTTATACTAAATTGCACCTACCT[G/A]
CCAAGTTCGTGTATTAGAATGCTCATTTTTCAAGATATTGCACCAAATTGCACCCACCTGCCAAGTTGATGCACCGTGGATGCAATTTACTCTATTTTTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.90%	4.00%	0.02%	0.00%	NA
All Indica	2759	98.20%	1.80%	0.00%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	48.30%	51.30%	0.37%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	96.60%	3.40%	0.00%	0.00%	NA
Indica III	913	99.00%	1.00%	0.00%	0.00%	NA
Indica Intermediate	786	96.90%	3.10%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221514962	C -> T	LOC_Os02g35810.1	upstream_gene_variant ; 1324.0bp to feature; MODIFIER	silent_mutation	Average:30.444; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0221514962	C -> T	LOC_Os02g35820.1	upstream_gene_variant ; 3805.0bp to feature; MODIFIER	silent_mutation	Average:30.444; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0221514962	C -> T	LOC_Os02g35820.2	upstream_gene_variant ; 3805.0bp to feature; MODIFIER	silent_mutation	Average:30.444; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0221514962	C -> T	LOC_Os02g35800.1	downstream_gene_variant ; 3670.0bp to feature; MODIFIER	silent_mutation	Average:30.444; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0221514962	C -> T	LOC_Os02g35810-LOC_Os02g35820	intergenic_region ; MODIFIER	silent_mutation	Average:30.444; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221514962	NA	2.97E-07	mr1530	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221514962	NA	1.57E-11	mr1612	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221514962	NA	1.61E-18	mr1855	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221514962	NA	3.32E-09	mr1166_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221514962	6.00E-06	NA	mr1248_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221514962	4.60E-07	NA	mr1263_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221514962	NA	2.83E-06	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221514962	NA	2.52E-10	mr1897_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251