Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0221478143:

Variant ID: vg0221478143 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 21478143
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCCACTGGCACCGCAGCAATGAGCTTGGGCGCGGAGGGCATCCATCTTAGCGATTGCCGCGGCCTTCTATCCTCGAGGCGTCGTTAGCGGATGCAGAGC[C/T]
GCCACTTCATTTCATACTGGAGCTAGAGGGATTGAGGAAAACGATTCAAATAGTAGGTAATGGTTGCGTAGAGGCTGACATGTCTTCTGGTAGGGAAGAG

Reverse complement sequence

CTCTTCCCTACCAGAAGACATGTCAGCCTCTACGCAACCATTACCTACTATTTGAATCGTTTTCCTCAATCCCTCTAGCTCCAGTATGAAATGAAGTGGC[G/A]
GCTCTGCATCCGCTAACGACGCCTCGAGGATAGAAGGCCGCGGCAATCGCTAAGATGGATGCCCTCCGCGCCCAAGCTCATTGCTGCGGTGCCAGTGGAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.20%	38.60%	0.04%	0.13%	NA
All Indica	2759	94.80%	5.00%	0.00%	0.14%	NA
All Japonica	1512	3.60%	96.30%	0.00%	0.07%	NA
Aus	269	65.80%	33.80%	0.37%	0.00%	NA
Indica I	595	98.30%	1.50%	0.00%	0.17%	NA
Indica II	465	96.80%	3.00%	0.00%	0.22%	NA
Indica III	913	91.70%	8.20%	0.00%	0.11%	NA
Indica Intermediate	786	94.70%	5.20%	0.00%	0.13%	NA
Temperate Japonica	767	1.30%	98.60%	0.00%	0.13%	NA
Tropical Japonica	504	6.90%	93.10%	0.00%	0.00%	NA
Japonica Intermediate	241	4.10%	95.90%	0.00%	0.00%	NA
VI/Aromatic	96	9.40%	90.60%	0.00%	0.00%	NA
Intermediate	90	38.90%	58.90%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221478143	C -> T	LOC_Os02g35760.1	upstream_gene_variant ; 511.0bp to feature; MODIFIER	silent_mutation	Average:69.08; most accessible tissue: Zhenshan97 young leaf, score: 87.153	N	N	N	N
vg0221478143	C -> T	LOC_Os02g35760.2	upstream_gene_variant ; 511.0bp to feature; MODIFIER	silent_mutation	Average:69.08; most accessible tissue: Zhenshan97 young leaf, score: 87.153	N	N	N	N
vg0221478143	C -> T	LOC_Os02g35750.1	downstream_gene_variant ; 4321.0bp to feature; MODIFIER	silent_mutation	Average:69.08; most accessible tissue: Zhenshan97 young leaf, score: 87.153	N	N	N	N
vg0221478143	C -> T	LOC_Os02g35750.2	downstream_gene_variant ; 2675.0bp to feature; MODIFIER	silent_mutation	Average:69.08; most accessible tissue: Zhenshan97 young leaf, score: 87.153	N	N	N	N
vg0221478143	C -> T	LOC_Os02g35750.3	downstream_gene_variant ; 2510.0bp to feature; MODIFIER	silent_mutation	Average:69.08; most accessible tissue: Zhenshan97 young leaf, score: 87.153	N	N	N	N
vg0221478143	C -> T	LOC_Os02g35760-LOC_Os02g35770	intergenic_region ; MODIFIER	silent_mutation	Average:69.08; most accessible tissue: Zhenshan97 young leaf, score: 87.153	N	N	N	N
vg0221478143	C -> DEL	N	N	silent_mutation	Average:69.08; most accessible tissue: Zhenshan97 young leaf, score: 87.153	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221478143	NA	1.84E-09	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221478143	NA	9.48E-61	mr1246	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221478143	NA	2.43E-06	mr1911	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221478143	7.85E-08	7.85E-08	mr1918	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221478143	NA	3.49E-75	mr1246_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221478143	NA	6.07E-08	mr1911_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221478143	NA	2.34E-06	mr1946_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221478143	NA	2.34E-06	mr1948_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251