\
| Variant ID: vg0221444241 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 21444241 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATTTGAAGTAAATTTTAAGGTTTTTTTTATCGAAGTTTATTTTTCAGCCTTTGTTTTTACATCGCTAAGAACAAATACATAAAAGTTTTATTCACAAATT[G/A]
CTTTTTATTTGTAAATATACCGTTTTGCTTATTCCGCTGATAAGTCAAACAATCTCTGATATGAACTCTTGGACAGAAAGGAGCTAGAAGATATGTGAAG
CTTCACATATCTTCTAGCTCCTTTCTGTCCAAGAGTTCATATCAGAGATTGTTTGACTTATCAGCGGAATAAGCAAAACGGTATATTTACAAATAAAAAG[C/T]
AATTTGTGAATAAAACTTTTATGTATTTGTTCTTAGCGATGTAAAAACAAAGGCTGAAAAATAAACTTCGATAAAAAAAACCTTAAAATTTACTTCAAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.40% | 0.80% | 0.83% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 95.00% | 2.50% | 2.51% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 91.70% | 5.00% | 3.39% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.30% | 0.00% | 3.73% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0221444241 | G -> A | LOC_Os02g35660.1 | upstream_gene_variant ; 3577.0bp to feature; MODIFIER | silent_mutation | Average:35.078; most accessible tissue: Callus, score: 84.128 | N | N | N | N |
| vg0221444241 | G -> A | LOC_Os02g35670.1 | downstream_gene_variant ; 794.0bp to feature; MODIFIER | silent_mutation | Average:35.078; most accessible tissue: Callus, score: 84.128 | N | N | N | N |
| vg0221444241 | G -> A | LOC_Os02g35680.1 | downstream_gene_variant ; 2336.0bp to feature; MODIFIER | silent_mutation | Average:35.078; most accessible tissue: Callus, score: 84.128 | N | N | N | N |
| vg0221444241 | G -> A | LOC_Os02g35660-LOC_Os02g35670 | intergenic_region ; MODIFIER | silent_mutation | Average:35.078; most accessible tissue: Callus, score: 84.128 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0221444241 | NA | 5.97E-07 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221444241 | NA | 2.40E-08 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221444241 | NA | 8.99E-07 | mr1515 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221444241 | NA | 1.30E-08 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221444241 | NA | 8.73E-08 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221444241 | NA | 1.13E-06 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221444241 | 6.67E-09 | 6.99E-12 | mr1305_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221444241 | NA | 6.15E-06 | mr1409_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221444241 | NA | 7.98E-11 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221444241 | 8.85E-06 | 5.58E-07 | mr1703_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |