\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221444241:

Variant ID: vg0221444241 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21444241
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTGAAGTAAATTTTAAGGTTTTTTTTATCGAAGTTTATTTTTCAGCCTTTGTTTTTACATCGCTAAGAACAAATACATAAAAGTTTTATTCACAAATT[G/A]
CTTTTTATTTGTAAATATACCGTTTTGCTTATTCCGCTGATAAGTCAAACAATCTCTGATATGAACTCTTGGACAGAAAGGAGCTAGAAGATATGTGAAG

Reverse complement sequence

CTTCACATATCTTCTAGCTCCTTTCTGTCCAAGAGTTCATATCAGAGATTGTTTGACTTATCAGCGGAATAAGCAAAACGGTATATTTACAAATAAAAAG[C/T]
AATTTGTGAATAAAACTTTTATGTATTTGTTCTTAGCGATGTAAAAACAAAGGCTGAAAAATAAACTTCGATAAAAAAAACCTTAAAATTTACTTCAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.40% 0.80% 0.83% 0.00% NA
All Indica  2759 100.00% 0.00% 0.04% 0.00% NA
All Japonica  1512 95.00% 2.50% 2.51% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.00% 0.13% 0.00% NA
Temperate Japonica  767 91.70% 5.00% 3.39% 0.00% NA
Tropical Japonica  504 99.40% 0.00% 0.60% 0.00% NA
Japonica Intermediate  241 96.30% 0.00% 3.73% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221444241 G -> A LOC_Os02g35660.1 upstream_gene_variant ; 3577.0bp to feature; MODIFIER silent_mutation Average:35.078; most accessible tissue: Callus, score: 84.128 N N N N
vg0221444241 G -> A LOC_Os02g35670.1 downstream_gene_variant ; 794.0bp to feature; MODIFIER silent_mutation Average:35.078; most accessible tissue: Callus, score: 84.128 N N N N
vg0221444241 G -> A LOC_Os02g35680.1 downstream_gene_variant ; 2336.0bp to feature; MODIFIER silent_mutation Average:35.078; most accessible tissue: Callus, score: 84.128 N N N N
vg0221444241 G -> A LOC_Os02g35660-LOC_Os02g35670 intergenic_region ; MODIFIER silent_mutation Average:35.078; most accessible tissue: Callus, score: 84.128 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221444241 NA 5.97E-07 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221444241 NA 2.40E-08 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221444241 NA 8.99E-07 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221444241 NA 1.30E-08 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221444241 NA 8.73E-08 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221444241 NA 1.13E-06 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221444241 6.67E-09 6.99E-12 mr1305_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221444241 NA 6.15E-06 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221444241 NA 7.98E-11 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221444241 8.85E-06 5.58E-07 mr1703_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251