Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221436059:

Variant ID: vg0221436059 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 21436059
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.09, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:

AATTGAGTTCGAGTTCAGTTTACTAGCTACAACCATGCCGTCTTCCTGAAATTGAGTTCAACTGCGTGAAAATTGTGAAACGTAGCGTTAAACATTTGAC[C/T]
GTCCATGTATTTATGTTTCATATATACATACCCAAATTCATATGAATGTTAGACAAAAGATGGAAAGGCCGAAACATCTTATAATAGGAACAAATGGAGT

Reverse complement sequence

ACTCCATTTGTTCCTATTATAAGATGTTTCGGCCTTTCCATCTTTTGTCTAACATTCATATGAATTTGGGTATGTATATATGAAACATAAATACATGGAC[G/A]
GTCAAATGTTTAACGCTACGTTTCACAATTTTCACGCAGTTGAACTCAATTTCAGGAAGACGGCATGGTTGTAGCTAGTAAACTGAACTCGAACTCAATT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.70%	44.90%	0.40%	0.08%	NA
All Indica	2759	88.70%	10.60%	0.58%	0.11%	NA
All Japonica	1512	3.00%	96.80%	0.13%	0.07%	NA
Aus	269	18.20%	81.80%	0.00%	0.00%	NA
Indica I	595	97.80%	1.70%	0.50%	0.00%	NA
Indica II	465	81.50%	17.40%	1.08%	0.00%	NA
Indica III	913	88.80%	11.00%	0.00%	0.22%	NA
Indica Intermediate	786	86.00%	12.80%	1.02%	0.13%	NA
Temperate Japonica	767	1.20%	98.70%	0.00%	0.13%	NA
Tropical Japonica	504	6.20%	93.70%	0.20%	0.00%	NA
Japonica Intermediate	241	2.10%	97.50%	0.41%	0.00%	NA
VI/Aromatic	96	5.20%	94.80%	0.00%	0.00%	NA
Intermediate	90	40.00%	58.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221436059	C -> T	LOC_Os02g35640.1	upstream_gene_variant ; 1076.0bp to feature; MODIFIER	silent_mutation	Average:60.655; most accessible tissue: Callus, score: 79.29	N	N	N	N
vg0221436059	C -> T	LOC_Os02g35630.1	downstream_gene_variant ; 4345.0bp to feature; MODIFIER	silent_mutation	Average:60.655; most accessible tissue: Callus, score: 79.29	N	N	N	N
vg0221436059	C -> T	LOC_Os02g35650.1	downstream_gene_variant ; 69.0bp to feature; MODIFIER	silent_mutation	Average:60.655; most accessible tissue: Callus, score: 79.29	N	N	N	N
vg0221436059	C -> T	LOC_Os02g35660.1	downstream_gene_variant ; 240.0bp to feature; MODIFIER	silent_mutation	Average:60.655; most accessible tissue: Callus, score: 79.29	N	N	N	N
vg0221436059	C -> T	LOC_Os02g35650-LOC_Os02g35660	intergenic_region ; MODIFIER	silent_mutation	Average:60.655; most accessible tissue: Callus, score: 79.29	N	N	N	N
vg0221436059	C -> DEL	N	N	silent_mutation	Average:60.655; most accessible tissue: Callus, score: 79.29	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221436059	NA	2.36E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221436059	NA	4.53E-12	mr1914	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221436059	6.03E-06	6.03E-06	mr1918	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221436059	NA	4.78E-22	mr1943	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221436059	2.46E-06	NA	mr1509_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221436059	NA	5.62E-06	mr1911_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251