\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221436059:

Variant ID: vg0221436059 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21436059
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.09, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


AATTGAGTTCGAGTTCAGTTTACTAGCTACAACCATGCCGTCTTCCTGAAATTGAGTTCAACTGCGTGAAAATTGTGAAACGTAGCGTTAAACATTTGAC[C/T]
GTCCATGTATTTATGTTTCATATATACATACCCAAATTCATATGAATGTTAGACAAAAGATGGAAAGGCCGAAACATCTTATAATAGGAACAAATGGAGT

Reverse complement sequence

ACTCCATTTGTTCCTATTATAAGATGTTTCGGCCTTTCCATCTTTTGTCTAACATTCATATGAATTTGGGTATGTATATATGAAACATAAATACATGGAC[G/A]
GTCAAATGTTTAACGCTACGTTTCACAATTTTCACGCAGTTGAACTCAATTTCAGGAAGACGGCATGGTTGTAGCTAGTAAACTGAACTCGAACTCAATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.70% 44.90% 0.40% 0.08% NA
All Indica  2759 88.70% 10.60% 0.58% 0.11% NA
All Japonica  1512 3.00% 96.80% 0.13% 0.07% NA
Aus  269 18.20% 81.80% 0.00% 0.00% NA
Indica I  595 97.80% 1.70% 0.50% 0.00% NA
Indica II  465 81.50% 17.40% 1.08% 0.00% NA
Indica III  913 88.80% 11.00% 0.00% 0.22% NA
Indica Intermediate  786 86.00% 12.80% 1.02% 0.13% NA
Temperate Japonica  767 1.20% 98.70% 0.00% 0.13% NA
Tropical Japonica  504 6.20% 93.70% 0.20% 0.00% NA
Japonica Intermediate  241 2.10% 97.50% 0.41% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 40.00% 58.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221436059 C -> T LOC_Os02g35640.1 upstream_gene_variant ; 1076.0bp to feature; MODIFIER silent_mutation Average:60.655; most accessible tissue: Callus, score: 79.29 N N N N
vg0221436059 C -> T LOC_Os02g35630.1 downstream_gene_variant ; 4345.0bp to feature; MODIFIER silent_mutation Average:60.655; most accessible tissue: Callus, score: 79.29 N N N N
vg0221436059 C -> T LOC_Os02g35650.1 downstream_gene_variant ; 69.0bp to feature; MODIFIER silent_mutation Average:60.655; most accessible tissue: Callus, score: 79.29 N N N N
vg0221436059 C -> T LOC_Os02g35660.1 downstream_gene_variant ; 240.0bp to feature; MODIFIER silent_mutation Average:60.655; most accessible tissue: Callus, score: 79.29 N N N N
vg0221436059 C -> T LOC_Os02g35650-LOC_Os02g35660 intergenic_region ; MODIFIER silent_mutation Average:60.655; most accessible tissue: Callus, score: 79.29 N N N N
vg0221436059 C -> DEL N N silent_mutation Average:60.655; most accessible tissue: Callus, score: 79.29 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221436059 NA 2.36E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221436059 NA 4.53E-12 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221436059 6.03E-06 6.03E-06 mr1918 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221436059 NA 4.78E-22 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221436059 2.46E-06 NA mr1509_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221436059 NA 5.62E-06 mr1911_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251