\
| Variant ID: vg0221436059 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 21436059 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.09, others allele: 0.00, population size: 84. )
AATTGAGTTCGAGTTCAGTTTACTAGCTACAACCATGCCGTCTTCCTGAAATTGAGTTCAACTGCGTGAAAATTGTGAAACGTAGCGTTAAACATTTGAC[C/T]
GTCCATGTATTTATGTTTCATATATACATACCCAAATTCATATGAATGTTAGACAAAAGATGGAAAGGCCGAAACATCTTATAATAGGAACAAATGGAGT
ACTCCATTTGTTCCTATTATAAGATGTTTCGGCCTTTCCATCTTTTGTCTAACATTCATATGAATTTGGGTATGTATATATGAAACATAAATACATGGAC[G/A]
GTCAAATGTTTAACGCTACGTTTCACAATTTTCACGCAGTTGAACTCAATTTCAGGAAGACGGCATGGTTGTAGCTAGTAAACTGAACTCGAACTCAATT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.70% | 44.90% | 0.40% | 0.08% | NA |
| All Indica | 2759 | 88.70% | 10.60% | 0.58% | 0.11% | NA |
| All Japonica | 1512 | 3.00% | 96.80% | 0.13% | 0.07% | NA |
| Aus | 269 | 18.20% | 81.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.80% | 1.70% | 0.50% | 0.00% | NA |
| Indica II | 465 | 81.50% | 17.40% | 1.08% | 0.00% | NA |
| Indica III | 913 | 88.80% | 11.00% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 86.00% | 12.80% | 1.02% | 0.13% | NA |
| Temperate Japonica | 767 | 1.20% | 98.70% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 6.20% | 93.70% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 40.00% | 58.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0221436059 | C -> T | LOC_Os02g35640.1 | upstream_gene_variant ; 1076.0bp to feature; MODIFIER | silent_mutation | Average:60.655; most accessible tissue: Callus, score: 79.29 | N | N | N | N |
| vg0221436059 | C -> T | LOC_Os02g35630.1 | downstream_gene_variant ; 4345.0bp to feature; MODIFIER | silent_mutation | Average:60.655; most accessible tissue: Callus, score: 79.29 | N | N | N | N |
| vg0221436059 | C -> T | LOC_Os02g35650.1 | downstream_gene_variant ; 69.0bp to feature; MODIFIER | silent_mutation | Average:60.655; most accessible tissue: Callus, score: 79.29 | N | N | N | N |
| vg0221436059 | C -> T | LOC_Os02g35660.1 | downstream_gene_variant ; 240.0bp to feature; MODIFIER | silent_mutation | Average:60.655; most accessible tissue: Callus, score: 79.29 | N | N | N | N |
| vg0221436059 | C -> T | LOC_Os02g35650-LOC_Os02g35660 | intergenic_region ; MODIFIER | silent_mutation | Average:60.655; most accessible tissue: Callus, score: 79.29 | N | N | N | N |
| vg0221436059 | C -> DEL | N | N | silent_mutation | Average:60.655; most accessible tissue: Callus, score: 79.29 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0221436059 | NA | 2.36E-06 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221436059 | NA | 4.53E-12 | mr1914 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221436059 | 6.03E-06 | 6.03E-06 | mr1918 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221436059 | NA | 4.78E-22 | mr1943 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221436059 | 2.46E-06 | NA | mr1509_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221436059 | NA | 5.62E-06 | mr1911_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |