\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221393191:

Variant ID: vg0221393191 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21393191
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGATGTCACTATATTTAATTCGATTGTTCTAATTTTGTTGTCAACATTTTTTATTTCAATGTGTTGTTAACTACTATTCCCTCCATCCCATAATATAAGA[C/T]
GCGCGCGTATTTCAAGATTCAACATTTAACCAACATTTAGTACAATATGAAATAAAATTTATTTGTTAAAAAATATACCATTAGATTGGCATTTAAATTT

Reverse complement sequence

AAATTTAAATGCCAATCTAATGGTATATTTTTTAACAAATAAATTTTATTTCATATTGTACTAAATGTTGGTTAAATGTTGAATCTTGAAATACGCGCGC[G/A]
TCTTATATTATGGGATGGAGGGAATAGTAGTTAACAACACATTGAAATAAAAAATGTTGACAACAAAATTAGAACAATCGAATTAAATATAGTGACATCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.70% 7.00% 2.26% 0.00% NA
All Indica  2759 99.50% 0.40% 0.07% 0.00% NA
All Japonica  1512 72.20% 21.00% 6.88% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.30% 0.13% 0.00% NA
Temperate Japonica  767 51.50% 38.60% 9.91% 0.00% NA
Tropical Japonica  504 97.40% 0.60% 1.98% 0.00% NA
Japonica Intermediate  241 85.10% 7.50% 7.47% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 4.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221393191 C -> T LOC_Os02g35560.1 downstream_gene_variant ; 3094.0bp to feature; MODIFIER silent_mutation Average:53.069; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg0221393191 C -> T LOC_Os02g35540-LOC_Os02g35560 intergenic_region ; MODIFIER silent_mutation Average:53.069; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221393191 NA 8.84E-06 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221393191 NA 6.04E-06 mr1185_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221393191 2.15E-06 NA mr1269_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221393191 NA 3.99E-06 mr1269_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221393191 9.61E-06 NA mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221393191 NA 8.22E-08 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221393191 NA 7.42E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221393191 NA 4.34E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221393191 NA 1.41E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221393191 NA 4.67E-06 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251