\
| Variant ID: vg0221393191 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 21393191 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGATGTCACTATATTTAATTCGATTGTTCTAATTTTGTTGTCAACATTTTTTATTTCAATGTGTTGTTAACTACTATTCCCTCCATCCCATAATATAAGA[C/T]
GCGCGCGTATTTCAAGATTCAACATTTAACCAACATTTAGTACAATATGAAATAAAATTTATTTGTTAAAAAATATACCATTAGATTGGCATTTAAATTT
AAATTTAAATGCCAATCTAATGGTATATTTTTTAACAAATAAATTTTATTTCATATTGTACTAAATGTTGGTTAAATGTTGAATCTTGAAATACGCGCGC[G/A]
TCTTATATTATGGGATGGAGGGAATAGTAGTTAACAACACATTGAAATAAAAAATGTTGACAACAAAATTAGAACAATCGAATTAAATATAGTGACATCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.70% | 7.00% | 2.26% | 0.00% | NA |
| All Indica | 2759 | 99.50% | 0.40% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 72.20% | 21.00% | 6.88% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 51.50% | 38.60% | 9.91% | 0.00% | NA |
| Tropical Japonica | 504 | 97.40% | 0.60% | 1.98% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.10% | 7.50% | 7.47% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 4.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0221393191 | C -> T | LOC_Os02g35560.1 | downstream_gene_variant ; 3094.0bp to feature; MODIFIER | silent_mutation | Average:53.069; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0221393191 | C -> T | LOC_Os02g35540-LOC_Os02g35560 | intergenic_region ; MODIFIER | silent_mutation | Average:53.069; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0221393191 | NA | 8.84E-06 | mr1043_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221393191 | NA | 6.04E-06 | mr1185_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221393191 | 2.15E-06 | NA | mr1269_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221393191 | NA | 3.99E-06 | mr1269_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221393191 | 9.61E-06 | NA | mr1502_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221393191 | NA | 8.22E-08 | mr1502_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221393191 | NA | 7.42E-08 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221393191 | NA | 4.34E-08 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221393191 | NA | 1.41E-08 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221393191 | NA | 4.67E-06 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |