Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221243033:

Variant ID: vg0221243033 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 21243033
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.12, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

ATAAGATGAATAATTCAGATTACTTTCTACTACCACTAGAATAAGATGAACGATTCAGGCTACTTTCTACTAATTACAAAACACCATATTGGGGCTCATC[G/A]
TGAGCACAATTTCGTGTAGAACCTATGAGTCGAGTAAATATTATATATTTATTTATTTATTTATTTGTCACTGGCCTAGTGGCCTCTCCGGCTATCGCAC

Reverse complement sequence

GTGCGATAGCCGGAGAGGCCACTAGGCCAGTGACAAATAAATAAATAAATAAATATATAATATTTACTCGACTCATAGGTTCTACACGAAATTGTGCTCA[C/T]
GATGAGCCCCAATATGGTGTTTTGTAATTAGTAGAAAGTAGCCTGAATCGTTCATCTTATTCTAGTGGTAGTAGAAAGTAATCTGAATTATTCATCTTAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.40%	7.00%	0.28%	0.38%	NA
All Indica	2759	95.30%	3.60%	0.43%	0.65%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	26.80%	72.90%	0.37%	0.00%	NA
Indica I	595	99.70%	0.20%	0.00%	0.17%	NA
Indica II	465	93.10%	4.70%	1.29%	0.86%	NA
Indica III	913	95.80%	3.60%	0.22%	0.33%	NA
Indica Intermediate	786	92.70%	5.50%	0.51%	1.27%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	74.00%	26.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221243033	G -> A	LOC_Os02g35320.1	upstream_gene_variant ; 218.0bp to feature; MODIFIER	silent_mutation	Average:84.125; most accessible tissue: Minghui63 flag leaf, score: 92.844	N	N	N	N
vg0221243033	G -> A	LOC_Os02g35315-LOC_Os02g35320	intergenic_region ; MODIFIER	silent_mutation	Average:84.125; most accessible tissue: Minghui63 flag leaf, score: 92.844	N	N	N	N
vg0221243033	G -> DEL	N	N	silent_mutation	Average:84.125; most accessible tissue: Minghui63 flag leaf, score: 92.844	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0221243033	G	A	-0.03	-0.12	-0.16	-0.04	-0.07	-0.05

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221243033	NA	1.47E-12	mr1612	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221243033	NA	6.49E-29	mr1098_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221243033	NA	4.13E-24	mr1099_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221243033	NA	7.45E-17	mr1119_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221243033	NA	1.27E-22	mr1120_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221243033	NA	2.99E-22	mr1123_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221243033	NA	6.22E-10	mr1166_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221243033	NA	1.70E-23	mr1247_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221243033	3.87E-06	1.88E-11	mr1612_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221243033	NA	7.33E-29	mr1757_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221243033	NA	3.47E-13	mr1914_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221243033	NA	5.99E-06	mr1929_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221243033	NA	1.84E-15	mr1936_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221243033	NA	1.08E-14	mr1961_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251