\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221243033:

Variant ID: vg0221243033 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21243033
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.12, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


ATAAGATGAATAATTCAGATTACTTTCTACTACCACTAGAATAAGATGAACGATTCAGGCTACTTTCTACTAATTACAAAACACCATATTGGGGCTCATC[G/A]
TGAGCACAATTTCGTGTAGAACCTATGAGTCGAGTAAATATTATATATTTATTTATTTATTTATTTGTCACTGGCCTAGTGGCCTCTCCGGCTATCGCAC

Reverse complement sequence

GTGCGATAGCCGGAGAGGCCACTAGGCCAGTGACAAATAAATAAATAAATAAATATATAATATTTACTCGACTCATAGGTTCTACACGAAATTGTGCTCA[C/T]
GATGAGCCCCAATATGGTGTTTTGTAATTAGTAGAAAGTAGCCTGAATCGTTCATCTTATTCTAGTGGTAGTAGAAAGTAATCTGAATTATTCATCTTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.40% 7.00% 0.28% 0.38% NA
All Indica  2759 95.30% 3.60% 0.43% 0.65% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 26.80% 72.90% 0.37% 0.00% NA
Indica I  595 99.70% 0.20% 0.00% 0.17% NA
Indica II  465 93.10% 4.70% 1.29% 0.86% NA
Indica III  913 95.80% 3.60% 0.22% 0.33% NA
Indica Intermediate  786 92.70% 5.50% 0.51% 1.27% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 74.00% 26.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221243033 G -> A LOC_Os02g35320.1 upstream_gene_variant ; 218.0bp to feature; MODIFIER silent_mutation Average:84.125; most accessible tissue: Minghui63 flag leaf, score: 92.844 N N N N
vg0221243033 G -> A LOC_Os02g35315-LOC_Os02g35320 intergenic_region ; MODIFIER silent_mutation Average:84.125; most accessible tissue: Minghui63 flag leaf, score: 92.844 N N N N
vg0221243033 G -> DEL N N silent_mutation Average:84.125; most accessible tissue: Minghui63 flag leaf, score: 92.844 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0221243033 G A -0.03 -0.12 -0.16 -0.04 -0.07 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221243033 NA 1.47E-12 mr1612 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221243033 NA 6.49E-29 mr1098_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221243033 NA 4.13E-24 mr1099_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221243033 NA 7.45E-17 mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221243033 NA 1.27E-22 mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221243033 NA 2.99E-22 mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221243033 NA 6.22E-10 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221243033 NA 1.70E-23 mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221243033 3.87E-06 1.88E-11 mr1612_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221243033 NA 7.33E-29 mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221243033 NA 3.47E-13 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221243033 NA 5.99E-06 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221243033 NA 1.84E-15 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221243033 NA 1.08E-14 mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251