\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221240541:

Variant ID: vg0221240541 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21240541
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.11, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


GACAAGGACTACTCGCATTGTATCCATATTGGTTTCCATAGTTCTACTTGGACAAGGGGACACGACACCTATGGGTATAAATACAAAGCCCCTAAGAGAA[G/A]
AGGGGACACGAAGCAACATACAAGCCAACATACGCCAAGACAAGACGCTAGATATCGACTTCAGAGATAAACATGGCTAGTCCCCTACGGTGCCTACGGA

Reverse complement sequence

TCCGTAGGCACCGTAGGGGACTAGCCATGTTTATCTCTGAAGTCGATATCTAGCGTCTTGTCTTGGCGTATGTTGGCTTGTATGTTGCTTCGTGTCCCCT[C/T]
TTCTCTTAGGGGCTTTGTATTTATACCCATAGGTGTCGTGTCCCCTTGTCCAAGTAGAACTATGGAAACCAATATGGATACAATGCGAGTAGTCCTTGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.10% 16.20% 0.13% 49.62% NA
All Indica  2759 1.50% 18.10% 0.11% 80.32% NA
All Japonica  1512 98.00% 0.50% 0.00% 1.52% NA
Aus  269 0.00% 73.20% 0.00% 26.77% NA
Indica I  595 2.20% 5.00% 0.00% 92.77% NA
Indica II  465 1.30% 17.80% 0.00% 80.86% NA
Indica III  913 0.90% 26.70% 0.22% 72.18% NA
Indica Intermediate  786 1.80% 18.10% 0.13% 80.03% NA
Temperate Japonica  767 98.60% 0.00% 0.00% 1.43% NA
Tropical Japonica  504 98.20% 0.60% 0.00% 1.19% NA
Japonica Intermediate  241 95.90% 1.70% 0.00% 2.49% NA
VI/Aromatic  96 43.80% 51.00% 0.00% 5.21% NA
Intermediate  90 50.00% 14.40% 3.33% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221240541 G -> A LOC_Os02g35315.1 upstream_gene_variant ; 4430.0bp to feature; MODIFIER silent_mutation Average:53.624; most accessible tissue: Minghui63 flower, score: 75.217 N N N N
vg0221240541 G -> A LOC_Os02g35320.1 upstream_gene_variant ; 2710.0bp to feature; MODIFIER silent_mutation Average:53.624; most accessible tissue: Minghui63 flower, score: 75.217 N N N N
vg0221240541 G -> A LOC_Os02g35315.2 upstream_gene_variant ; 4430.0bp to feature; MODIFIER silent_mutation Average:53.624; most accessible tissue: Minghui63 flower, score: 75.217 N N N N
vg0221240541 G -> A LOC_Os02g35315-LOC_Os02g35320 intergenic_region ; MODIFIER silent_mutation Average:53.624; most accessible tissue: Minghui63 flower, score: 75.217 N N N N
vg0221240541 G -> DEL N N silent_mutation Average:53.624; most accessible tissue: Minghui63 flower, score: 75.217 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221240541 NA 1.64E-11 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221240541 NA 2.14E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221240541 NA 4.29E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221240541 3.93E-06 NA mr1156_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221240541 NA 9.69E-08 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221240541 6.93E-06 NA mr1186_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221240541 3.18E-06 NA mr1245_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221240541 NA 8.94E-07 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221240541 NA 2.16E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221240541 NA 1.79E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221240541 3.93E-06 NA mr1332_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221240541 4.35E-06 NA mr1352_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221240541 NA 2.70E-08 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221240541 1.80E-06 NA mr1445_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221240541 NA 5.91E-08 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221240541 NA 5.47E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221240541 NA 3.31E-14 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221240541 2.73E-06 3.07E-06 mr1616_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221240541 NA 3.79E-06 mr1633_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221240541 NA 5.33E-14 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221240541 NA 1.95E-14 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221240541 NA 4.97E-07 mr1652_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221240541 NA 3.36E-19 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221240541 NA 4.47E-11 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221240541 NA 1.83E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221240541 2.46E-06 4.97E-07 mr1706_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221240541 NA 4.98E-21 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221240541 NA 1.40E-16 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221240541 NA 2.82E-15 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221240541 NA 1.61E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221240541 5.55E-07 NA mr1977_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251