\
| Variant ID: vg0221239428 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 21239428 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACTTTATCTAATATCATATGAGAATTTTACAAATCGTGCAAGTACTATGTGTTATGTGTTGCTCTAAATTTTACATTTAGAGGGTGAGAAGGACCTAAAT[G/A]
CAAATATTTCTGAACCCCGTGCTGCCACGTCACATAAATCGCTCTCTATTAGAGCAATTTTTAAAAATCATATATTTTTGTTAATGTTAAAAACAGTAAT
ATTACTGTTTTTAACATTAACAAAAATATATGATTTTTAAAAATTGCTCTAATAGAGAGCGATTTATGTGACGTGGCAGCACGGGGTTCAGAAATATTTG[C/T]
ATTTAGGTCCTTCTCACCCTCTAAATGTAAAATTTAGAGCAACACATAACACATAGTACTTGCACGATTTGTAAAATTCTCATATGATATTAGATAAAGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.70% | 3.30% | 0.99% | 0.00% | NA |
| All Indica | 2759 | 92.70% | 5.70% | 1.67% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.20% | 0.50% | 0.00% | NA |
| Indica II | 465 | 82.20% | 13.50% | 4.30% | 0.00% | NA |
| Indica III | 913 | 96.80% | 3.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 89.10% | 8.10% | 2.80% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0221239428 | G -> A | LOC_Os02g35315.1 | upstream_gene_variant ; 3317.0bp to feature; MODIFIER | silent_mutation | Average:35.531; most accessible tissue: Callus, score: 86.103 | N | N | N | N |
| vg0221239428 | G -> A | LOC_Os02g35320.1 | upstream_gene_variant ; 3823.0bp to feature; MODIFIER | silent_mutation | Average:35.531; most accessible tissue: Callus, score: 86.103 | N | N | N | N |
| vg0221239428 | G -> A | LOC_Os02g35315.2 | upstream_gene_variant ; 3317.0bp to feature; MODIFIER | silent_mutation | Average:35.531; most accessible tissue: Callus, score: 86.103 | N | N | N | N |
| vg0221239428 | G -> A | LOC_Os02g35315-LOC_Os02g35320 | intergenic_region ; MODIFIER | silent_mutation | Average:35.531; most accessible tissue: Callus, score: 86.103 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0221239428 | NA | 4.53E-06 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221239428 | NA | 3.41E-06 | mr1150 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221239428 | NA | 3.87E-06 | mr1589 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221239428 | NA | 1.14E-07 | mr1918 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221239428 | 2.57E-07 | 4.30E-08 | mr1929 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221239428 | NA | 2.57E-08 | mr1077_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221239428 | NA | 1.91E-06 | mr1150_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221239428 | NA | 2.20E-06 | mr1918_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |