Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221239428:

Variant ID: vg0221239428 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 21239428
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTTTATCTAATATCATATGAGAATTTTACAAATCGTGCAAGTACTATGTGTTATGTGTTGCTCTAAATTTTACATTTAGAGGGTGAGAAGGACCTAAAT[G/A]
CAAATATTTCTGAACCCCGTGCTGCCACGTCACATAAATCGCTCTCTATTAGAGCAATTTTTAAAAATCATATATTTTTGTTAATGTTAAAAACAGTAAT

Reverse complement sequence

ATTACTGTTTTTAACATTAACAAAAATATATGATTTTTAAAAATTGCTCTAATAGAGAGCGATTTATGTGACGTGGCAGCACGGGGTTCAGAAATATTTG[C/T]
ATTTAGGTCCTTCTCACCCTCTAAATGTAAAATTTAGAGCAACACATAACACATAGTACTTGCACGATTTGTAAAATTCTCATATGATATTAGATAAAGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.70%	3.30%	0.99%	0.00%	NA
All Indica	2759	92.70%	5.70%	1.67%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.30%	0.20%	0.50%	0.00%	NA
Indica II	465	82.20%	13.50%	4.30%	0.00%	NA
Indica III	913	96.80%	3.10%	0.11%	0.00%	NA
Indica Intermediate	786	89.10%	8.10%	2.80%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	1.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221239428	G -> A	LOC_Os02g35315.1	upstream_gene_variant ; 3317.0bp to feature; MODIFIER	silent_mutation	Average:35.531; most accessible tissue: Callus, score: 86.103	N	N	N	N
vg0221239428	G -> A	LOC_Os02g35320.1	upstream_gene_variant ; 3823.0bp to feature; MODIFIER	silent_mutation	Average:35.531; most accessible tissue: Callus, score: 86.103	N	N	N	N
vg0221239428	G -> A	LOC_Os02g35315.2	upstream_gene_variant ; 3317.0bp to feature; MODIFIER	silent_mutation	Average:35.531; most accessible tissue: Callus, score: 86.103	N	N	N	N
vg0221239428	G -> A	LOC_Os02g35315-LOC_Os02g35320	intergenic_region ; MODIFIER	silent_mutation	Average:35.531; most accessible tissue: Callus, score: 86.103	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221239428	NA	4.53E-06	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221239428	NA	3.41E-06	mr1150	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221239428	NA	3.87E-06	mr1589	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221239428	NA	1.14E-07	mr1918	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221239428	2.57E-07	4.30E-08	mr1929	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221239428	NA	2.57E-08	mr1077_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221239428	NA	1.91E-06	mr1150_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221239428	NA	2.20E-06	mr1918_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251