\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221239428:

Variant ID: vg0221239428 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21239428
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTTTATCTAATATCATATGAGAATTTTACAAATCGTGCAAGTACTATGTGTTATGTGTTGCTCTAAATTTTACATTTAGAGGGTGAGAAGGACCTAAAT[G/A]
CAAATATTTCTGAACCCCGTGCTGCCACGTCACATAAATCGCTCTCTATTAGAGCAATTTTTAAAAATCATATATTTTTGTTAATGTTAAAAACAGTAAT

Reverse complement sequence

ATTACTGTTTTTAACATTAACAAAAATATATGATTTTTAAAAATTGCTCTAATAGAGAGCGATTTATGTGACGTGGCAGCACGGGGTTCAGAAATATTTG[C/T]
ATTTAGGTCCTTCTCACCCTCTAAATGTAAAATTTAGAGCAACACATAACACATAGTACTTGCACGATTTGTAAAATTCTCATATGATATTAGATAAAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.70% 3.30% 0.99% 0.00% NA
All Indica  2759 92.70% 5.70% 1.67% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.30% 0.20% 0.50% 0.00% NA
Indica II  465 82.20% 13.50% 4.30% 0.00% NA
Indica III  913 96.80% 3.10% 0.11% 0.00% NA
Indica Intermediate  786 89.10% 8.10% 2.80% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 1.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221239428 G -> A LOC_Os02g35315.1 upstream_gene_variant ; 3317.0bp to feature; MODIFIER silent_mutation Average:35.531; most accessible tissue: Callus, score: 86.103 N N N N
vg0221239428 G -> A LOC_Os02g35320.1 upstream_gene_variant ; 3823.0bp to feature; MODIFIER silent_mutation Average:35.531; most accessible tissue: Callus, score: 86.103 N N N N
vg0221239428 G -> A LOC_Os02g35315.2 upstream_gene_variant ; 3317.0bp to feature; MODIFIER silent_mutation Average:35.531; most accessible tissue: Callus, score: 86.103 N N N N
vg0221239428 G -> A LOC_Os02g35315-LOC_Os02g35320 intergenic_region ; MODIFIER silent_mutation Average:35.531; most accessible tissue: Callus, score: 86.103 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221239428 NA 4.53E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221239428 NA 3.41E-06 mr1150 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221239428 NA 3.87E-06 mr1589 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221239428 NA 1.14E-07 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221239428 2.57E-07 4.30E-08 mr1929 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221239428 NA 2.57E-08 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221239428 NA 1.91E-06 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221239428 NA 2.20E-06 mr1918_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251