\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221233160:

Variant ID: vg0221233160 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 21233160
Reference Allele: CAlternative Allele: T,CGT
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


AAGTTAGAAATCAGTATATATCTGTTTTCTATCTCTAATCTAATCTAACTATTTAAAAAGAGAAAATGCATGAGAAAATAAAAACGGTTCAAAAAAAAGG[C/T,CGT]
GTGAGAAAAAAGTCAGAAAAAAGCGCAAAAAAAACACTCTAAAAAGGTTTTCCATCTTCCATAAAAAAATAAGAAAAGTGCGAGAAAAGTTATTTCCATC

Reverse complement sequence

GATGGAAATAACTTTTCTCGCACTTTTCTTATTTTTTTATGGAAGATGGAAAACCTTTTTAGAGTGTTTTTTTTGCGCTTTTTTCTGACTTTTTTCTCAC[G/A,ACG]
CCTTTTTTTTGAACCGTTTTTATTTTCTCATGCATTTTCTCTTTTTAAATAGTTAGATTAGATTAGAGATAGAAAACAGATATATACTGATTTCTAACTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.00% 15.00% 0.25% 0.00% CGT: 0.70%
All Indica  2759 82.10% 16.30% 0.43% 0.00% CGT: 1.16%
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 28.30% 71.40% 0.00% 0.00% CGT: 0.37%
Indica I  595 95.10% 4.90% 0.00% 0.00% NA
Indica II  465 82.80% 17.20% 0.00% 0.00% NA
Indica III  913 73.20% 22.70% 1.10% 0.00% CGT: 3.07%
Indica Intermediate  786 82.30% 16.90% 0.25% 0.00% CGT: 0.51%
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 49.00% 51.00% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221233160 C -> CGT LOC_Os02g35310.1 upstream_gene_variant ; 1795.0bp to feature; MODIFIER silent_mutation Average:20.132; most accessible tissue: Callus, score: 32.067 N N N N
vg0221233160 C -> CGT LOC_Os02g35300.1 downstream_gene_variant ; 4454.0bp to feature; MODIFIER silent_mutation Average:20.132; most accessible tissue: Callus, score: 32.067 N N N N
vg0221233160 C -> CGT LOC_Os02g35315.1 downstream_gene_variant ; 1390.0bp to feature; MODIFIER silent_mutation Average:20.132; most accessible tissue: Callus, score: 32.067 N N N N
vg0221233160 C -> CGT LOC_Os02g35300.2 downstream_gene_variant ; 4454.0bp to feature; MODIFIER silent_mutation Average:20.132; most accessible tissue: Callus, score: 32.067 N N N N
vg0221233160 C -> CGT LOC_Os02g35300.3 downstream_gene_variant ; 4429.0bp to feature; MODIFIER silent_mutation Average:20.132; most accessible tissue: Callus, score: 32.067 N N N N
vg0221233160 C -> CGT LOC_Os02g35315.2 downstream_gene_variant ; 1390.0bp to feature; MODIFIER silent_mutation Average:20.132; most accessible tissue: Callus, score: 32.067 N N N N
vg0221233160 C -> CGT LOC_Os02g35310-LOC_Os02g35315 intergenic_region ; MODIFIER silent_mutation Average:20.132; most accessible tissue: Callus, score: 32.067 N N N N
vg0221233160 C -> T LOC_Os02g35310.1 upstream_gene_variant ; 1794.0bp to feature; MODIFIER silent_mutation Average:20.132; most accessible tissue: Callus, score: 32.067 N N N N
vg0221233160 C -> T LOC_Os02g35300.1 downstream_gene_variant ; 4453.0bp to feature; MODIFIER silent_mutation Average:20.132; most accessible tissue: Callus, score: 32.067 N N N N
vg0221233160 C -> T LOC_Os02g35315.1 downstream_gene_variant ; 1391.0bp to feature; MODIFIER silent_mutation Average:20.132; most accessible tissue: Callus, score: 32.067 N N N N
vg0221233160 C -> T LOC_Os02g35300.2 downstream_gene_variant ; 4453.0bp to feature; MODIFIER silent_mutation Average:20.132; most accessible tissue: Callus, score: 32.067 N N N N
vg0221233160 C -> T LOC_Os02g35300.3 downstream_gene_variant ; 4428.0bp to feature; MODIFIER silent_mutation Average:20.132; most accessible tissue: Callus, score: 32.067 N N N N
vg0221233160 C -> T LOC_Os02g35315.2 downstream_gene_variant ; 1391.0bp to feature; MODIFIER silent_mutation Average:20.132; most accessible tissue: Callus, score: 32.067 N N N N
vg0221233160 C -> T LOC_Os02g35310-LOC_Os02g35315 intergenic_region ; MODIFIER silent_mutation Average:20.132; most accessible tissue: Callus, score: 32.067 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221233160 1.54E-06 6.10E-07 mr1197 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221233160 NA 7.63E-06 mr1705 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221233160 NA 2.48E-06 mr1908 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251