\
| Variant ID: vg0221220533 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 21220533 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CAGCCGTGCAGGCGGAAACACCAGTCGGCGGCGGACGAGGCGGCCGGTCGGTGAAGACGTGGACGCCCAACAGACGGCGGCATAATAGGCCAGCCCTGCA[G/A]
GCGGAGACACCAGTCGGCGGCGGCGAAGGGAAGCCGATGGTGATGTTCTGATTGATCCATTCCTGAAGCGTAGGAAATAAGCTTAAAGCCATGAATCCCT
AGGGATTCATGGCTTTAAGCTTATTTCCTACGCTTCAGGAATGGATCAATCAGAACATCACCATCGGCTTCCCTTCGCCGCCGCCGACTGGTGTCTCCGC[C/T]
TGCAGGGCTGGCCTATTATGCCGCCGTCTGTTGGGCGTCCACGTCTTCACCGACCGGCCGCCTCGTCCGCCGCCGACTGGTGTTTCCGCCTGCACGGCTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.20% | 0.70% | 8.53% | 0.57% | NA |
| All Indica | 2759 | 84.50% | 1.00% | 13.56% | 0.94% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 95.30% | 0.20% | 3.87% | 0.67% | NA |
| Indica II | 465 | 87.50% | 0.60% | 11.40% | 0.43% | NA |
| Indica III | 913 | 72.60% | 2.20% | 23.99% | 1.20% | NA |
| Indica Intermediate | 786 | 88.40% | 0.40% | 10.05% | 1.15% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 77.10% | 3.10% | 19.79% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 2.20% | 7.78% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0221220533 | G -> A | LOC_Os02g35300.1 | upstream_gene_variant ; 4510.0bp to feature; MODIFIER | silent_mutation | Average:38.031; most accessible tissue: Zhenshan97 flower, score: 47.586 | N | N | N | N |
| vg0221220533 | G -> A | LOC_Os02g35300.2 | upstream_gene_variant ; 4510.0bp to feature; MODIFIER | silent_mutation | Average:38.031; most accessible tissue: Zhenshan97 flower, score: 47.586 | N | N | N | N |
| vg0221220533 | G -> A | LOC_Os02g35300.3 | upstream_gene_variant ; 4510.0bp to feature; MODIFIER | silent_mutation | Average:38.031; most accessible tissue: Zhenshan97 flower, score: 47.586 | N | N | N | N |
| vg0221220533 | G -> A | LOC_Os02g35290-LOC_Os02g35300 | intergenic_region ; MODIFIER | silent_mutation | Average:38.031; most accessible tissue: Zhenshan97 flower, score: 47.586 | N | N | N | N |
| vg0221220533 | G -> DEL | N | N | silent_mutation | Average:38.031; most accessible tissue: Zhenshan97 flower, score: 47.586 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0221220533 | NA | 5.59E-06 | mr1380 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221220533 | 4.33E-06 | 2.45E-06 | mr1561 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221220533 | NA | 7.83E-06 | mr1160_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |