\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221220533:

Variant ID: vg0221220533 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21220533
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGCCGTGCAGGCGGAAACACCAGTCGGCGGCGGACGAGGCGGCCGGTCGGTGAAGACGTGGACGCCCAACAGACGGCGGCATAATAGGCCAGCCCTGCA[G/A]
GCGGAGACACCAGTCGGCGGCGGCGAAGGGAAGCCGATGGTGATGTTCTGATTGATCCATTCCTGAAGCGTAGGAAATAAGCTTAAAGCCATGAATCCCT

Reverse complement sequence

AGGGATTCATGGCTTTAAGCTTATTTCCTACGCTTCAGGAATGGATCAATCAGAACATCACCATCGGCTTCCCTTCGCCGCCGCCGACTGGTGTCTCCGC[C/T]
TGCAGGGCTGGCCTATTATGCCGCCGTCTGTTGGGCGTCCACGTCTTCACCGACCGGCCGCCTCGTCCGCCGCCGACTGGTGTTTCCGCCTGCACGGCTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.20% 0.70% 8.53% 0.57% NA
All Indica  2759 84.50% 1.00% 13.56% 0.94% NA
All Japonica  1512 99.90% 0.00% 0.13% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 95.30% 0.20% 3.87% 0.67% NA
Indica II  465 87.50% 0.60% 11.40% 0.43% NA
Indica III  913 72.60% 2.20% 23.99% 1.20% NA
Indica Intermediate  786 88.40% 0.40% 10.05% 1.15% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 77.10% 3.10% 19.79% 0.00% NA
Intermediate  90 88.90% 2.20% 7.78% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221220533 G -> A LOC_Os02g35300.1 upstream_gene_variant ; 4510.0bp to feature; MODIFIER silent_mutation Average:38.031; most accessible tissue: Zhenshan97 flower, score: 47.586 N N N N
vg0221220533 G -> A LOC_Os02g35300.2 upstream_gene_variant ; 4510.0bp to feature; MODIFIER silent_mutation Average:38.031; most accessible tissue: Zhenshan97 flower, score: 47.586 N N N N
vg0221220533 G -> A LOC_Os02g35300.3 upstream_gene_variant ; 4510.0bp to feature; MODIFIER silent_mutation Average:38.031; most accessible tissue: Zhenshan97 flower, score: 47.586 N N N N
vg0221220533 G -> A LOC_Os02g35290-LOC_Os02g35300 intergenic_region ; MODIFIER silent_mutation Average:38.031; most accessible tissue: Zhenshan97 flower, score: 47.586 N N N N
vg0221220533 G -> DEL N N silent_mutation Average:38.031; most accessible tissue: Zhenshan97 flower, score: 47.586 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221220533 NA 5.59E-06 mr1380 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221220533 4.33E-06 2.45E-06 mr1561 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221220533 NA 7.83E-06 mr1160_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251