Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221220533:

Variant ID: vg0221220533 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 21220533
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAGCCGTGCAGGCGGAAACACCAGTCGGCGGCGGACGAGGCGGCCGGTCGGTGAAGACGTGGACGCCCAACAGACGGCGGCATAATAGGCCAGCCCTGCA[G/A]
GCGGAGACACCAGTCGGCGGCGGCGAAGGGAAGCCGATGGTGATGTTCTGATTGATCCATTCCTGAAGCGTAGGAAATAAGCTTAAAGCCATGAATCCCT

Reverse complement sequence

AGGGATTCATGGCTTTAAGCTTATTTCCTACGCTTCAGGAATGGATCAATCAGAACATCACCATCGGCTTCCCTTCGCCGCCGCCGACTGGTGTCTCCGC[C/T]
TGCAGGGCTGGCCTATTATGCCGCCGTCTGTTGGGCGTCCACGTCTTCACCGACCGGCCGCCTCGTCCGCCGCCGACTGGTGTTTCCGCCTGCACGGCTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.20%	0.70%	8.53%	0.57%	NA
All Indica	2759	84.50%	1.00%	13.56%	0.94%	NA
All Japonica	1512	99.90%	0.00%	0.13%	0.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	95.30%	0.20%	3.87%	0.67%	NA
Indica II	465	87.50%	0.60%	11.40%	0.43%	NA
Indica III	913	72.60%	2.20%	23.99%	1.20%	NA
Indica Intermediate	786	88.40%	0.40%	10.05%	1.15%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	77.10%	3.10%	19.79%	0.00%	NA
Intermediate	90	88.90%	2.20%	7.78%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221220533	G -> A	LOC_Os02g35300.1	upstream_gene_variant ; 4510.0bp to feature; MODIFIER	silent_mutation	Average:38.031; most accessible tissue: Zhenshan97 flower, score: 47.586	N	N	N	N
vg0221220533	G -> A	LOC_Os02g35300.2	upstream_gene_variant ; 4510.0bp to feature; MODIFIER	silent_mutation	Average:38.031; most accessible tissue: Zhenshan97 flower, score: 47.586	N	N	N	N
vg0221220533	G -> A	LOC_Os02g35300.3	upstream_gene_variant ; 4510.0bp to feature; MODIFIER	silent_mutation	Average:38.031; most accessible tissue: Zhenshan97 flower, score: 47.586	N	N	N	N
vg0221220533	G -> A	LOC_Os02g35290-LOC_Os02g35300	intergenic_region ; MODIFIER	silent_mutation	Average:38.031; most accessible tissue: Zhenshan97 flower, score: 47.586	N	N	N	N
vg0221220533	G -> DEL	N	N	silent_mutation	Average:38.031; most accessible tissue: Zhenshan97 flower, score: 47.586	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221220533	NA	5.59E-06	mr1380	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221220533	4.33E-06	2.45E-06	mr1561	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221220533	NA	7.83E-06	mr1160_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251