Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221212277:

Variant ID: vg0221212277 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 21212277
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

AAAGGGGGTGGCTATCAAGCTAAAAAAGTGGATGGATTTAAAGACAAGGAATTTTATACAGGTTCAGGCCTTCTTAATCAAGAAGTAATACCCTACTCTT[G/A]
TCCGGGGATTGATCCGCCGAGTGTATTATTGATCGTATGATCTGGAGAAAATCGTGCCCCTAAAAGCACCCGGACCCCTCCTTATATAGAGGAAGGGGAC

Reverse complement sequence

GTCCCCTTCCTCTATATAAGGAGGGGTCCGGGTGCTTTTAGGGGCACGATTTTCTCCAGATCATACGATCAATAATACACTCGGCGGATCAATCCCCGGA[C/T]
AAGAGTAGGGTATTACTTCTTGATTAAGAAGGCCTGAACCTGTATAAAATTCCTTGTCTTTAAATCCATCCACTTTTTTAGCTTGATAGCCACCCCCTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.40%	9.20%	0.38%	0.00%	NA
All Indica	2759	84.90%	14.50%	0.65%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	95.30%	4.70%	0.00%	0.00%	NA
Indica II	465	86.50%	12.70%	0.86%	0.00%	NA
Indica III	913	75.50%	23.80%	0.77%	0.00%	NA
Indica Intermediate	786	87.00%	12.10%	0.89%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	75.00%	25.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221212277	G -> A	LOC_Os02g35290.1	upstream_gene_variant ; 462.0bp to feature; MODIFIER	silent_mutation	Average:54.529; most accessible tissue: Minghui63 flower, score: 68.878	N	N	N	N
vg0221212277	G -> A	LOC_Os02g35290-LOC_Os02g35300	intergenic_region ; MODIFIER	silent_mutation	Average:54.529; most accessible tissue: Minghui63 flower, score: 68.878	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221212277	NA	2.52E-06	mr1380	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221212277	NA	7.52E-08	mr1561	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221212277	NA	3.61E-06	mr1561	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221212277	NA	1.05E-06	mr1908	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221212277	4.58E-07	4.57E-07	mr1996	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221212277	NA	6.46E-06	mr1160_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221212277	NA	5.09E-06	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221212277	NA	1.49E-06	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221212277	NA	2.07E-06	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251