\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221209437:

Variant ID: vg0221209437 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21209437
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTCCTTGTCGCATGTGACGGCTTGCTTGATGTCACTCCACAGGGATATGACTCCTCGAGGACCAGGCATCTTCATCATCATGTAGGTATAGTGCAGGA[C/T]
AGCCATGAACTTGGCTAACGCCGGGCGTCCGAGTATGGCATGATATGCTGTCTCGAAATCAGCGACCTCAAAACAAATGTTCTCTGTACGGAAGTTCTCC

Reverse complement sequence

GGAGAACTTCCGTACAGAGAACATTTGTTTTGAGGTCGCTGATTTCGAGACAGCATATCATGCCATACTCGGACGCCCGGCGTTAGCCAAGTTCATGGCT[G/A]
TCCTGCACTATACCTACATGATGATGAAGATGCCTGGTCCTCGAGGAGTCATATCCCTGTGGAGTGACATCAAGCAAGCCGTCACATGCGACAAGGAAAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.10% 41.90% 0.93% 0.00% NA
All Indica  2759 83.30% 15.90% 0.87% 0.00% NA
All Japonica  1512 4.70% 94.00% 1.26% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 93.10% 6.10% 0.84% 0.00% NA
Indica II  465 84.90% 14.00% 1.08% 0.00% NA
Indica III  913 74.20% 25.10% 0.77% 0.00% NA
Indica Intermediate  786 85.40% 13.70% 0.89% 0.00% NA
Temperate Japonica  767 1.40% 97.30% 1.30% 0.00% NA
Tropical Japonica  504 3.20% 96.60% 0.20% 0.00% NA
Japonica Intermediate  241 18.30% 78.40% 3.32% 0.00% NA
VI/Aromatic  96 30.20% 69.80% 0.00% 0.00% NA
Intermediate  90 40.00% 58.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221209437 C -> T LOC_Os02g35290.1 missense_variant ; p.Val543Ile; MODERATE nonsynonymous_codon ; V543I Average:42.751; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 benign 0.416 DELETERIOUS 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221209437 6.26E-06 6.26E-06 mr1098 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209437 5.59E-06 NA mr1101 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209437 NA 1.53E-09 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209437 2.68E-07 2.68E-07 mr1232 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209437 NA 1.47E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209437 NA 2.59E-09 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209437 NA 9.16E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209437 NA 4.97E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209437 NA 9.14E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209437 NA 2.73E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209437 NA 2.39E-15 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209437 8.33E-06 8.33E-06 mr1655 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209437 NA 1.24E-08 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209437 NA 5.82E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209437 NA 5.59E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209437 4.83E-06 4.83E-06 mr1876 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209437 1.28E-07 1.28E-07 mr1918 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209437 NA 6.37E-06 mr1944 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209437 NA 2.51E-06 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209437 NA 5.39E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209437 NA 3.54E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209437 NA 7.31E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251