\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221209303:

Variant ID: vg0221209303 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21209303
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


TCTTGGTTTTGGCGTCGCTTTCTCCGCTCTTTGACATCTTGGTTGCAGGCACTTCTCCTTTGCTTGATATGGACGCAGCCAGTCGGATTTCTTCTCGGGC[G/A]
AGCGTGATCTCGCGGGTCTGGGCCATCTCGCAGCTTTCCTTGTCGCATGTGACGGCTTGCTTGATGTCACTCCACAGGGATATGACTCCTCGAGGACCAG

Reverse complement sequence

CTGGTCCTCGAGGAGTCATATCCCTGTGGAGTGACATCAAGCAAGCCGTCACATGCGACAAGGAAAGCTGCGAGATGGCCCAGACCCGCGAGATCACGCT[C/T]
GCCCGAGAAGAAATCCGACTGGCTGCGTCCATATCAAGCAAAGGAGAAGTGCCTGCAACCAAGATGTCAAAGAGCGGAGAAAGCGACGCCAAAACCAAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.40% 9.20% 0.25% 0.17% NA
All Indica  2759 84.80% 14.40% 0.43% 0.29% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 95.00% 4.70% 0.17% 0.17% NA
Indica II  465 86.70% 12.70% 0.43% 0.22% NA
Indica III  913 75.40% 23.70% 0.66% 0.33% NA
Indica Intermediate  786 87.20% 12.10% 0.38% 0.38% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 75.00% 25.00% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221209303 G -> A LOC_Os02g35290.1 synonymous_variant ; p.Leu587Leu; LOW synonymous_codon Average:35.946; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 N N N N
vg0221209303 G -> DEL LOC_Os02g35290.1 N frameshift_variant Average:35.946; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221209303 NA 1.06E-07 mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209303 NA 9.89E-08 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209303 NA 1.54E-08 mr1908 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209303 NA 6.21E-06 mr1908 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209303 1.89E-06 1.89E-06 mr1996 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209303 NA 4.11E-06 mr1160_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209303 NA 7.15E-06 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209303 NA 1.15E-06 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209303 NA 2.80E-06 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251