\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221202711:

Variant ID: vg0221202711 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21202711
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCCTTCCAAAACTCCACAGAAATCTTCCGCGCATCCACCGCACTGATCCCCATCCATTCCCAGCCATTTCCAAAGCAAATCGCATCATCCAATTCACAT[T/C]
CATGGCAGAGGAGAGAGAAAGCTTCAAGAGCCAATGGGCGCCCTCCGACGTCACCGAGGAGAGCTTGAAGGAAATGGTAGTACATGGTGTTCTTTCGGCA

Reverse complement sequence

TGCCGAAAGAACACCATGTACTACCATTTCCTTCAAGCTCTCCTCGGTGACGTCGGAGGGCGCCCATTGGCTCTTGAAGCTTTCTCTCTCCTCTGCCATG[A/G]
ATGTGAATTGGATGATGCGATTTGCTTTGGAAATGGCTGGGAATGGATGGGGATCAGTGCGGTGGATGCGCGGAAGATTTCTGTGGAGTTTTGGAAGGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.00% 31.80% 0.13% 0.08% NA
All Indica  2759 98.90% 0.90% 0.14% 0.11% NA
All Japonica  1512 6.40% 93.50% 0.00% 0.07% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.00% 0.70% 0.17% 0.17% NA
Indica II  465 98.70% 1.10% 0.00% 0.22% NA
Indica III  913 99.20% 0.50% 0.11% 0.11% NA
Indica Intermediate  786 98.50% 1.30% 0.25% 0.00% NA
Temperate Japonica  767 9.10% 90.70% 0.00% 0.13% NA
Tropical Japonica  504 2.80% 97.20% 0.00% 0.00% NA
Japonica Intermediate  241 5.40% 94.60% 0.00% 0.00% NA
VI/Aromatic  96 74.00% 26.00% 0.00% 0.00% NA
Intermediate  90 54.40% 43.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221202711 T -> DEL N N silent_mutation Average:51.346; most accessible tissue: Minghui63 young leaf, score: 68.745 N N N N
vg0221202711 T -> C LOC_Os02g35280.1 upstream_gene_variant ; 616.0bp to feature; MODIFIER silent_mutation Average:51.346; most accessible tissue: Minghui63 young leaf, score: 68.745 N N N N
vg0221202711 T -> C LOC_Os02g35290.1 downstream_gene_variant ; 3727.0bp to feature; MODIFIER silent_mutation Average:51.346; most accessible tissue: Minghui63 young leaf, score: 68.745 N N N N
vg0221202711 T -> C LOC_Os02g35270-LOC_Os02g35280 intergenic_region ; MODIFIER silent_mutation Average:51.346; most accessible tissue: Minghui63 young leaf, score: 68.745 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221202711 NA 6.67E-35 mr1105 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711 NA 2.27E-48 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711 NA 3.09E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711 NA 3.23E-21 mr1168 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711 NA 9.21E-46 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711 NA 4.87E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711 NA 1.93E-40 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711 NA 3.69E-17 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711 1.66E-07 7.25E-08 mr1559 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711 NA 2.07E-74 mr1629 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711 NA 2.40E-51 mr1692 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711 NA 3.02E-18 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711 NA 2.99E-22 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711 NA 7.85E-16 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711 NA 1.65E-32 mr1105_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711 NA 6.53E-54 mr1136_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711 NA 1.82E-52 mr1194_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711 NA 2.11E-09 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711 NA 2.42E-16 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711 NA 5.76E-14 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711 NA 4.71E-17 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711 NA 1.02E-11 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711 NA 9.02E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711 NA 5.80E-25 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711 NA 1.06E-16 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711 NA 4.14E-16 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711 NA 1.35E-41 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251