Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221202711:

Variant ID: vg0221202711 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 21202711
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCCTTCCAAAACTCCACAGAAATCTTCCGCGCATCCACCGCACTGATCCCCATCCATTCCCAGCCATTTCCAAAGCAAATCGCATCATCCAATTCACAT[T/C]
CATGGCAGAGGAGAGAGAAAGCTTCAAGAGCCAATGGGCGCCCTCCGACGTCACCGAGGAGAGCTTGAAGGAAATGGTAGTACATGGTGTTCTTTCGGCA

Reverse complement sequence

TGCCGAAAGAACACCATGTACTACCATTTCCTTCAAGCTCTCCTCGGTGACGTCGGAGGGCGCCCATTGGCTCTTGAAGCTTTCTCTCTCCTCTGCCATG[A/G]
ATGTGAATTGGATGATGCGATTTGCTTTGGAAATGGCTGGGAATGGATGGGGATCAGTGCGGTGGATGCGCGGAAGATTTCTGTGGAGTTTTGGAAGGCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.00%	31.80%	0.13%	0.08%	NA
All Indica	2759	98.90%	0.90%	0.14%	0.11%	NA
All Japonica	1512	6.40%	93.50%	0.00%	0.07%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.00%	0.70%	0.17%	0.17%	NA
Indica II	465	98.70%	1.10%	0.00%	0.22%	NA
Indica III	913	99.20%	0.50%	0.11%	0.11%	NA
Indica Intermediate	786	98.50%	1.30%	0.25%	0.00%	NA
Temperate Japonica	767	9.10%	90.70%	0.00%	0.13%	NA
Tropical Japonica	504	2.80%	97.20%	0.00%	0.00%	NA
Japonica Intermediate	241	5.40%	94.60%	0.00%	0.00%	NA
VI/Aromatic	96	74.00%	26.00%	0.00%	0.00%	NA
Intermediate	90	54.40%	43.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221202711	T -> DEL	N	N	silent_mutation	Average:51.346; most accessible tissue: Minghui63 young leaf, score: 68.745	N	N	N	N
vg0221202711	T -> C	LOC_Os02g35280.1	upstream_gene_variant ; 616.0bp to feature; MODIFIER	silent_mutation	Average:51.346; most accessible tissue: Minghui63 young leaf, score: 68.745	N	N	N	N
vg0221202711	T -> C	LOC_Os02g35290.1	downstream_gene_variant ; 3727.0bp to feature; MODIFIER	silent_mutation	Average:51.346; most accessible tissue: Minghui63 young leaf, score: 68.745	N	N	N	N
vg0221202711	T -> C	LOC_Os02g35270-LOC_Os02g35280	intergenic_region ; MODIFIER	silent_mutation	Average:51.346; most accessible tissue: Minghui63 young leaf, score: 68.745	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221202711	NA	6.67E-35	mr1105	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711	NA	2.27E-48	mr1136	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711	NA	3.09E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711	NA	3.23E-21	mr1168	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711	NA	9.21E-46	mr1194	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711	NA	4.87E-23	mr1383	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711	NA	1.93E-40	mr1480	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711	NA	3.69E-17	mr1557	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711	1.66E-07	7.25E-08	mr1559	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711	NA	2.07E-74	mr1629	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711	NA	2.40E-51	mr1692	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711	NA	3.02E-18	mr1715	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711	NA	2.99E-22	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711	NA	7.85E-16	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711	NA	1.65E-32	mr1105_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711	NA	6.53E-54	mr1136_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711	NA	1.82E-52	mr1194_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711	NA	2.11E-09	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711	NA	2.42E-16	mr1416_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711	NA	5.76E-14	mr1529_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711	NA	4.71E-17	mr1557_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711	NA	1.02E-11	mr1636_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711	NA	9.02E-10	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711	NA	5.80E-25	mr1653_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711	NA	1.06E-16	mr1715_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711	NA	4.14E-16	mr1767_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221202711	NA	1.35E-41	mr1944_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251