\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221164625:

Variant ID: vg0221164625 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 21164625
Reference Allele: CAlternative Allele: A,CAAAA,CAAA,CAA
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTACTCCCTATGTCCTATGATATAAGGAATTTTGAGCTCTGTCCCATGATATAAGGAATTTTGAGTTCTTGCTTTACACTGTTTGACCACTCGTCTTGTT[C/A,CAAAA,CAAA,CAA]
AAAAAAATTTTAGATTTATTATTTATTTTTTTTGACTTACTTTATTATCTAAAGTATTTTAAGCACAAATTTTCGTTTTTTATATTTGCACAAATTTTTT

Reverse complement sequence

AAAAAATTTGTGCAAATATAAAAAACGAAAATTTGTGCTTAAAATACTTTAGATAATAAAGTAAGTCAAAAAAAATAAATAATAAATCTAAAATTTTTTT[G/T,TTTTG,TTTG,TTG]
AACAAGACGAGTGGTCAAACAGTGTAAAGCAAGAACTCAAAATTCCTTATATCATGGGACAGAGCTCAAAATTCCTTATATCATAGGACATAGGGAGTAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.50% 39.80% 3.09% 0.00% CAAA: 6.20%; CAA: 0.30%; CAAAA: 0.06%
All Indica  2759 81.60% 10.40% 4.60% 0.00% CAAA: 3.30%; CAAAA: 0.04%; CAA: 0.04%
All Japonica  1512 0.80% 98.70% 0.13% 0.00% CAAA: 0.33%
Aus  269 26.40% 0.70% 4.09% 0.00% CAAA: 64.68%; CAA: 3.72%; CAAAA: 0.37%
Indica I  595 73.60% 14.30% 12.10% 0.00% NA
Indica II  465 79.60% 16.10% 2.58% 0.00% CAAA: 1.72%
Indica III  913 91.10% 3.70% 1.20% 0.00% CAAA: 3.83%; CAAAA: 0.11%
Indica Intermediate  786 77.90% 11.80% 4.07% 0.00% CAAA: 6.11%; CAA: 0.13%
Temperate Japonica  767 0.50% 99.30% 0.13% 0.00% NA
Tropical Japonica  504 1.00% 98.40% 0.20% 0.00% CAAA: 0.40%
Japonica Intermediate  241 1.20% 97.50% 0.00% 0.00% CAAA: 1.24%
VI/Aromatic  96 26.00% 49.00% 3.12% 0.00% CAAA: 17.71%; CAA: 3.12%; CAAAA: 1.04%
Intermediate  90 30.00% 60.00% 3.33% 0.00% CAAA: 6.67%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221164625 C -> A LOC_Os02g35190.1 upstream_gene_variant ; 3255.0bp to feature; MODIFIER silent_mutation Average:86.212; most accessible tissue: Minghui63 flag leaf, score: 95.638 N N N N
vg0221164625 C -> A LOC_Os02g35200.1 upstream_gene_variant ; 410.0bp to feature; MODIFIER silent_mutation Average:86.212; most accessible tissue: Minghui63 flag leaf, score: 95.638 N N N N
vg0221164625 C -> A LOC_Os02g35210.1 upstream_gene_variant ; 2053.0bp to feature; MODIFIER silent_mutation Average:86.212; most accessible tissue: Minghui63 flag leaf, score: 95.638 N N N N
vg0221164625 C -> A LOC_Os02g35190-LOC_Os02g35200 intergenic_region ; MODIFIER silent_mutation Average:86.212; most accessible tissue: Minghui63 flag leaf, score: 95.638 N N N N
vg0221164625 C -> CAAA LOC_Os02g35190.1 upstream_gene_variant ; 3256.0bp to feature; MODIFIER silent_mutation Average:86.212; most accessible tissue: Minghui63 flag leaf, score: 95.638 N N N N
vg0221164625 C -> CAAA LOC_Os02g35200.1 upstream_gene_variant ; 409.0bp to feature; MODIFIER silent_mutation Average:86.212; most accessible tissue: Minghui63 flag leaf, score: 95.638 N N N N
vg0221164625 C -> CAAA LOC_Os02g35210.1 upstream_gene_variant ; 2052.0bp to feature; MODIFIER silent_mutation Average:86.212; most accessible tissue: Minghui63 flag leaf, score: 95.638 N N N N
vg0221164625 C -> CAAA LOC_Os02g35190-LOC_Os02g35200 intergenic_region ; MODIFIER silent_mutation Average:86.212; most accessible tissue: Minghui63 flag leaf, score: 95.638 N N N N
vg0221164625 C -> CAAAA LOC_Os02g35190.1 upstream_gene_variant ; 3256.0bp to feature; MODIFIER silent_mutation Average:86.212; most accessible tissue: Minghui63 flag leaf, score: 95.638 N N N N
vg0221164625 C -> CAAAA LOC_Os02g35200.1 upstream_gene_variant ; 409.0bp to feature; MODIFIER silent_mutation Average:86.212; most accessible tissue: Minghui63 flag leaf, score: 95.638 N N N N
vg0221164625 C -> CAAAA LOC_Os02g35210.1 upstream_gene_variant ; 2052.0bp to feature; MODIFIER silent_mutation Average:86.212; most accessible tissue: Minghui63 flag leaf, score: 95.638 N N N N
vg0221164625 C -> CAAAA LOC_Os02g35190-LOC_Os02g35200 intergenic_region ; MODIFIER silent_mutation Average:86.212; most accessible tissue: Minghui63 flag leaf, score: 95.638 N N N N
vg0221164625 C -> CAA LOC_Os02g35190.1 upstream_gene_variant ; 3256.0bp to feature; MODIFIER silent_mutation Average:86.212; most accessible tissue: Minghui63 flag leaf, score: 95.638 N N N N
vg0221164625 C -> CAA LOC_Os02g35200.1 upstream_gene_variant ; 409.0bp to feature; MODIFIER silent_mutation Average:86.212; most accessible tissue: Minghui63 flag leaf, score: 95.638 N N N N
vg0221164625 C -> CAA LOC_Os02g35210.1 upstream_gene_variant ; 2052.0bp to feature; MODIFIER silent_mutation Average:86.212; most accessible tissue: Minghui63 flag leaf, score: 95.638 N N N N
vg0221164625 C -> CAA LOC_Os02g35190-LOC_Os02g35200 intergenic_region ; MODIFIER silent_mutation Average:86.212; most accessible tissue: Minghui63 flag leaf, score: 95.638 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0221164625 C A 0.01 0.01 0.0 0.0 0.0 0.0
vg0221164625 C CAA 0.16 0.12 0.11 0.09 0.13 0.13
vg0221164625 C CAAA 0.21 0.2 0.12 0.16 0.15 0.18
vg0221164625 C CAAAA 0.07 0.06 0.01 0.07 0.06 0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221164625 NA 9.95E-49 mr1063 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221164625 NA 2.15E-56 mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221164625 NA 3.65E-33 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221164625 NA 1.50E-09 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221164625 NA 8.46E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221164625 NA 1.29E-18 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221164625 NA 1.81E-31 mr1243 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221164625 NA 1.12E-25 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221164625 NA 1.50E-18 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221164625 NA 5.61E-32 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221164625 NA 3.01E-36 mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221164625 NA 7.98E-25 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221164625 NA 1.96E-25 mr1551 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221164625 NA 2.50E-16 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221164625 NA 1.15E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221164625 NA 9.56E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221164625 NA 3.96E-28 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221164625 NA 2.02E-16 mr1870 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221164625 NA 1.30E-31 mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221164625 2.20E-07 7.78E-67 mr1109_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221164625 NA 3.95E-36 mr1129_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221164625 NA 1.86E-35 mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221164625 NA 2.28E-22 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221164625 NA 1.85E-15 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221164625 NA 4.79E-45 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221164625 NA 7.80E-17 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251