\
| Variant ID: vg0221147432 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 21147432 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CTTGAAGGACTAATATGGACACATTGAAATATTAAGGACTAAACTGATCCTTGCATGAAACTTGGAGGACTATTTTACCTATTCACCCAAAACTTAAAAT[G/T]
AGATGTTTGATTAAAAACATGAGTTTAATCAAACAAAATTTAACCAAAATCTCTTATATTTTGTGATGGAGGAAATATTTATTTAGCAACAAAGTTGCTA
TAGCAACTTTGTTGCTAAATAAATATTTCCTCCATCACAAAATATAAGAGATTTTGGTTAAATTTTGTTTGATTAAACTCATGTTTTTAATCAAACATCT[C/A]
ATTTTAAGTTTTGGGTGAATAGGTAAAATAGTCCTCCAAGTTTCATGCAAGGATCAGTTTAGTCCTTAATATTTCAATGTGTCCATATTAGTCCTTCAAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.10% | 40.80% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 95.70% | 4.20% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 1.50% | 98.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 24.90% | 75.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.80% | 2.80% | 0.43% | 0.00% | NA |
| Indica III | 913 | 94.90% | 5.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 1.40% | 98.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 29.20% | 70.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 42.20% | 57.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0221147432 | G -> T | LOC_Os02g35190.1 | downstream_gene_variant ; 3270.0bp to feature; MODIFIER | silent_mutation | Average:30.884; most accessible tissue: Callus, score: 56.862 | N | N | N | N |
| vg0221147432 | G -> T | LOC_Os02g35190.2 | downstream_gene_variant ; 3270.0bp to feature; MODIFIER | silent_mutation | Average:30.884; most accessible tissue: Callus, score: 56.862 | N | N | N | N |
| vg0221147432 | G -> T | LOC_Os02g35180-LOC_Os02g35190 | intergenic_region ; MODIFIER | silent_mutation | Average:30.884; most accessible tissue: Callus, score: 56.862 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0221147432 | NA | 2.17E-48 | mr1063 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 2.20E-57 | mr1109 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 6.91E-34 | mr1129 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 2.52E-42 | mr1144 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 1.67E-09 | mr1151 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 6.69E-19 | mr1179 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 6.16E-32 | mr1243 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 3.53E-26 | mr1251 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 4.99E-17 | mr1253 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 2.36E-19 | mr1255 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 4.44E-33 | mr1257 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 1.27E-09 | mr1299 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 1.72E-36 | mr1435 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 4.81E-26 | mr1537 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 9.06E-27 | mr1551 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 1.26E-42 | mr1591 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 8.05E-08 | mr1610 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 1.29E-28 | mr1638 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 8.05E-12 | mr1657 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 4.22E-17 | mr1700 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 2.10E-11 | mr1720 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 5.11E-07 | mr1756 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 4.78E-29 | mr1793 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 1.97E-15 | mr1870 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 5.01E-32 | mr1037_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | 3.52E-06 | 5.71E-67 | mr1109_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 5.49E-36 | mr1129_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 2.44E-12 | mr1151_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 2.44E-20 | mr1183_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 1.62E-36 | mr1208_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 1.10E-35 | mr1257_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 9.54E-22 | mr1551_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 6.69E-15 | mr1720_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221147432 | NA | 3.12E-47 | mr1793_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |