\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221138308:

Variant ID: vg0221138308 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21138308
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCAATTGACCCGCGGTATAAAAGGGACCCCCGGGAGGACCTAAGGCATCGAATCTCACCGCCAACACAACCACCACAGCTTACGAAGTCGGAGCCTACAG[A/G]
AGCCAAGTCGCCGGGTGATCTAGTCGAACCAACTCGACTACGGTCTCGTCGGTATCATCGAGTTCCGCTATTCCCCTTGTAATATGTAGTTTCCATTATA

Reverse complement sequence

TATAATGGAAACTACATATTACAAGGGGAATAGCGGAACTCGATGATACCGACGAGACCGTAGTCGAGTTGGTTCGACTAGATCACCCGGCGACTTGGCT[T/C]
CTGTAGGCTCCGACTTCGTAAGCTGTGGTGGTTGTGTTGGCGGTGAGATTCGATGCCTTAGGTCCTCCCGGGGGTCCCTTTTATACCGCGGGTCAATTGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.60% 33.30% 0.55% 0.47% NA
All Indica  2759 97.30% 1.30% 0.65% 0.76% NA
All Japonica  1512 5.40% 94.10% 0.40% 0.07% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 98.30% 0.50% 0.67% 0.50% NA
Indica II  465 95.70% 1.90% 0.65% 1.72% NA
Indica III  913 97.90% 1.40% 0.22% 0.44% NA
Indica Intermediate  786 96.80% 1.30% 1.15% 0.76% NA
Temperate Japonica  767 8.90% 90.20% 0.78% 0.13% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 28.10% 71.90% 0.00% 0.00% NA
Intermediate  90 48.90% 48.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221138308 A -> G LOC_Os02g35180-LOC_Os02g35190 intergenic_region ; MODIFIER silent_mutation Average:55.72; most accessible tissue: Zhenshan97 root, score: 75.275 N N N N
vg0221138308 A -> DEL N N silent_mutation Average:55.72; most accessible tissue: Zhenshan97 root, score: 75.275 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221138308 NA 1.15E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221138308 NA 6.46E-14 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221138308 NA 4.47E-09 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221138308 3.58E-06 1.06E-11 mr1379 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221138308 NA 1.34E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221138308 NA 3.67E-09 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221138308 NA 1.99E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221138308 NA 1.26E-11 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221138308 NA 1.60E-08 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221138308 NA 2.46E-10 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221138308 NA 4.79E-23 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221138308 NA 1.14E-09 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221138308 NA 3.43E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251