\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221053349:

Variant ID: vg0221053349 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21053349
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCCGTTACCCGCATGGGTATGGGTATGGGGACGATTTTGTACCCGCGACGGGTGTGGGTATTTAAGTAGGAATATTTTAACATCATGGGTGTAGGGCTGT[G/C]
AACGAGCCAAGCTCGAGCGAGTTTGACTATGTAGGCTTGAGCTTGACATGAACTCGAGCCGAGCTCAAGCCGAGCCTGCCAGCCTGGATACTGATCGAGC

Reverse complement sequence

GCTCGATCAGTATCCAGGCTGGCAGGCTCGGCTTGAGCTCGGCTCGAGTTCATGTCAAGCTCAAGCCTACATAGTCAAACTCGCTCGAGCTTGGCTCGTT[C/G]
ACAGCCCTACACCCATGATGTTAAAATATTCCTACTTAAATACCCACACCCGTCGCGGGTACAAAATCGTCCCCATACCCATACCCATGCGGGTAACGGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.30% 34.30% 2.81% 19.55% NA
All Indica  2759 61.80% 2.60% 4.10% 31.53% NA
All Japonica  1512 6.00% 93.50% 0.07% 0.46% NA
Aus  269 79.20% 0.70% 6.69% 13.38% NA
Indica I  595 78.80% 1.30% 3.03% 16.81% NA
Indica II  465 63.90% 4.10% 4.09% 27.96% NA
Indica III  913 43.50% 3.10% 4.05% 49.40% NA
Indica Intermediate  786 69.00% 2.00% 4.96% 24.05% NA
Temperate Japonica  767 6.80% 93.10% 0.13% 0.00% NA
Tropical Japonica  504 5.20% 93.50% 0.00% 1.39% NA
Japonica Intermediate  241 5.00% 95.00% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 93.80% 0.00% 2.08% NA
Intermediate  90 37.80% 51.10% 1.11% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221053349 G -> DEL N N silent_mutation Average:75.058; most accessible tissue: Zhenshan97 flag leaf, score: 95.615 N N N N
vg0221053349 G -> C LOC_Os02g35070.1 upstream_gene_variant ; 2855.0bp to feature; MODIFIER silent_mutation Average:75.058; most accessible tissue: Zhenshan97 flag leaf, score: 95.615 N N N N
vg0221053349 G -> C LOC_Os02g35080.1 upstream_gene_variant ; 1041.0bp to feature; MODIFIER silent_mutation Average:75.058; most accessible tissue: Zhenshan97 flag leaf, score: 95.615 N N N N
vg0221053349 G -> C LOC_Os02g35080.4 upstream_gene_variant ; 1041.0bp to feature; MODIFIER silent_mutation Average:75.058; most accessible tissue: Zhenshan97 flag leaf, score: 95.615 N N N N
vg0221053349 G -> C LOC_Os02g35080.3 upstream_gene_variant ; 1041.0bp to feature; MODIFIER silent_mutation Average:75.058; most accessible tissue: Zhenshan97 flag leaf, score: 95.615 N N N N
vg0221053349 G -> C LOC_Os02g35080.5 upstream_gene_variant ; 1041.0bp to feature; MODIFIER silent_mutation Average:75.058; most accessible tissue: Zhenshan97 flag leaf, score: 95.615 N N N N
vg0221053349 G -> C LOC_Os02g35080.2 upstream_gene_variant ; 1041.0bp to feature; MODIFIER silent_mutation Average:75.058; most accessible tissue: Zhenshan97 flag leaf, score: 95.615 N N N N
vg0221053349 G -> C LOC_Os02g35080.6 upstream_gene_variant ; 3271.0bp to feature; MODIFIER silent_mutation Average:75.058; most accessible tissue: Zhenshan97 flag leaf, score: 95.615 N N N N
vg0221053349 G -> C LOC_Os02g35070-LOC_Os02g35080 intergenic_region ; MODIFIER silent_mutation Average:75.058; most accessible tissue: Zhenshan97 flag leaf, score: 95.615 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0221053349 G C 0.02 0.0 0.0 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221053349 NA 3.17E-68 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221053349 8.05E-07 NA mr1101 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221053349 NA 6.56E-81 mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221053349 NA 2.09E-74 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221053349 NA 1.20E-28 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221053349 NA 1.05E-18 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221053349 NA 9.73E-24 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221053349 NA 4.80E-87 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221053349 NA 1.28E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221053349 NA 2.38E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221053349 NA 1.55E-08 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221053349 NA 2.28E-40 mr1645 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221053349 NA 1.03E-33 mr1647 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221053349 NA 7.61E-34 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221053349 NA 1.52E-81 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221053349 NA 2.75E-37 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221053349 2.03E-06 2.03E-06 mr1717 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221053349 NA 6.58E-23 mr1754 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221053349 1.63E-06 NA mr1754 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221053349 NA 1.23E-17 mr1767 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221053349 NA 5.14E-25 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221053349 NA 2.85E-99 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221053349 NA 5.25E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221053349 NA 8.22E-31 mr1150_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221053349 NA 2.28E-23 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221053349 NA 8.78E-10 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251