Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221025908:

Variant ID: vg0221025908 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 21025908
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGTTTAATATTTCAAATATGTGTCAGTATATACGATGTAACACGCCAAAATTTTACACCTATGAATCTAAACACCCCCTTAGTGTGCGTGAAGATTCTGA[C/T]
GCCAAAGTTGTTCGGCGACCCCATCAATTGTGGTACTTAATATTGTGGTTAATATTGTGGTTTATACGAAGTTCTCGGTTTCAAAGCAGTAAGAAAATTT

Reverse complement sequence

AAATTTTCTTACTGCTTTGAAACCGAGAACTTCGTATAAACCACAATATTAACCACAATATTAAGTACCACAATTGATGGGGTCGCCGAACAACTTTGGC[G/A]
TCAGAATCTTCACGCACACTAAGGGGGTGTTTAGATTCATAGGTGTAAAATTTTGGCGTGTTACATCGTATATACTGACACATATTTGAAATATTAAACG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.50%	0.50%	1.35%	40.58%	NA
All Indica	2759	39.30%	0.70%	1.34%	58.68%	NA
All Japonica	1512	94.10%	0.10%	0.13%	5.69%	NA
Aus	269	21.90%	1.50%	8.55%	68.03%	NA
Indica I	595	21.80%	0.80%	0.34%	76.97%	NA
Indica II	465	36.10%	0.60%	1.08%	62.15%	NA
Indica III	913	57.80%	0.40%	1.86%	39.87%	NA
Indica Intermediate	786	32.70%	1.00%	1.65%	64.63%	NA
Temperate Japonica	767	93.40%	0.10%	0.13%	6.39%	NA
Tropical Japonica	504	95.00%	0.00%	0.20%	4.76%	NA
Japonica Intermediate	241	94.60%	0.00%	0.00%	5.39%	NA
VI/Aromatic	96	96.90%	0.00%	1.04%	2.08%	NA
Intermediate	90	67.80%	0.00%	1.11%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221025908	C -> T	LOC_Os02g35039.1	upstream_gene_variant ; 1821.0bp to feature; MODIFIER	silent_mutation	Average:36.163; most accessible tissue: Zhenshan97 flower, score: 69.437	N	N	N	N
vg0221025908	C -> T	LOC_Os02g35039.2	upstream_gene_variant ; 1821.0bp to feature; MODIFIER	silent_mutation	Average:36.163; most accessible tissue: Zhenshan97 flower, score: 69.437	N	N	N	N
vg0221025908	C -> T	LOC_Os02g35020-LOC_Os02g35039	intergenic_region ; MODIFIER	silent_mutation	Average:36.163; most accessible tissue: Zhenshan97 flower, score: 69.437	N	N	N	N
vg0221025908	C -> DEL	N	N	silent_mutation	Average:36.163; most accessible tissue: Zhenshan97 flower, score: 69.437	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221025908	3.00E-06	NA	mr1095	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221025908	3.50E-07	3.50E-07	mr1098	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221025908	1.05E-07	1.05E-07	mr1099	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221025908	7.24E-12	5.76E-09	mr1101	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221025908	5.01E-06	8.00E-06	mr1113	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221025908	4.53E-07	3.19E-06	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221025908	7.63E-09	1.40E-07	mr1150	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221025908	NA	9.36E-08	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221025908	2.09E-07	7.12E-06	mr1242	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221025908	6.45E-07	1.38E-06	mr1247	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221025908	NA	1.13E-12	mr1441	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221025908	NA	3.54E-07	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221025908	2.24E-06	2.24E-06	mr1589	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221025908	1.23E-06	4.74E-06	mr1754	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221025908	4.84E-07	5.01E-06	mr1858	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221025908	4.85E-07	5.01E-06	mr1859	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221025908	9.46E-06	9.46E-06	mr1880	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221025908	2.03E-06	7.10E-06	mr1917	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221025908	NA	6.88E-06	mr1921	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221025908	1.89E-08	3.76E-09	mr1098_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221025908	2.23E-07	2.03E-06	mr1099_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221025908	6.11E-06	2.50E-06	mr1114_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221025908	NA	5.59E-06	mr1120_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221025908	8.20E-08	4.02E-08	mr1150_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221025908	9.28E-06	3.14E-06	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221025908	4.98E-06	3.29E-06	mr1247_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221025908	NA	7.86E-06	mr1961_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251