\
| Variant ID: vg0221017633 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 21017633 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 195. )
TTTTAAAAAAAACTTAGGTGTTAAGTTTTCTTTGGCTTTTACCAATATGTGATCAGCAATCACTATTTCTGCATTTGGTCATTTTCTACTTTTCTTCAAA[C/T]
GACCAATTTCATAACATCTCCTCTATTACTTTCAGACCAAGACCAGAAAGTCATATGTGTCATAGCTTTCTTTCTTTCTTCTTGTTTTTTTTAAAGGAAT
ATTCCTTTAAAAAAAACAAGAAGAAAGAAAGAAAGCTATGACACATATGACTTTCTGGTCTTGGTCTGAAAGTAATAGAGGAGATGTTATGAAATTGGTC[G/A]
TTTGAAGAAAAGTAGAAAATGACCAAATGCAGAAATAGTGATTGCTGATCACATATTGGTAAAAGCCAAAGAAAACTTAACACCTAAGTTTTTTTTAAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.80% | 42.70% | 0.02% | 0.49% | NA |
| All Indica | 2759 | 38.30% | 60.90% | 0.00% | 0.76% | NA |
| All Japonica | 1512 | 94.00% | 6.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 21.60% | 77.70% | 0.00% | 0.74% | NA |
| Indica I | 595 | 21.20% | 78.20% | 0.00% | 0.67% | NA |
| Indica II | 465 | 35.50% | 63.90% | 0.00% | 0.65% | NA |
| Indica III | 913 | 56.80% | 42.30% | 0.00% | 0.88% | NA |
| Indica Intermediate | 786 | 31.40% | 67.80% | 0.00% | 0.76% | NA |
| Temperate Japonica | 767 | 93.20% | 6.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 3.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 36.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0221017633 | C -> T | LOC_Os02g35020.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.615; most accessible tissue: Zhenshan97 root, score: 88.318 | N | N | N | N |
| vg0221017633 | C -> DEL | N | N | silent_mutation | Average:62.615; most accessible tissue: Zhenshan97 root, score: 88.318 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0221017633 | 4.13E-06 | 8.75E-06 | mr1069 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221017633 | 4.34E-06 | 4.34E-06 | mr1099 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221017633 | 5.56E-07 | 3.96E-07 | mr1101 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221017633 | NA | 4.96E-13 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221017633 | 2.25E-06 | 3.43E-06 | mr1150 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221017633 | NA | 9.89E-08 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221017633 | NA | 2.29E-14 | mr1441 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221017633 | NA | 1.80E-07 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221017633 | NA | 3.22E-06 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221017633 | 3.52E-07 | 1.77E-08 | mr1098_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221017633 | 9.43E-06 | 5.86E-06 | mr1099_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221017633 | 8.82E-07 | 2.36E-07 | mr1150_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221017633 | NA | 4.54E-09 | mr1222_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221017633 | 8.14E-06 | 9.80E-06 | mr1247_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |