Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221010615:

Variant ID: vg0221010615 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 21010615
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGTTTTTAGTTTATCAGTCACAGCGAAAATTTGAATTAAAGCTTAATTTTAGAGTTGATTAGATATTATAGATGTTAATTACTTTTTAAAAAAAATTGGT[T/C]
AAACTTAGAGAACTTTTGTTTTTGGAGAAGATTGAAACACCTGACAACTAATATATGTTGAATGGAGGAAGTGTGTGTTTCGATTGGTGCAGAGTGAATG

Reverse complement sequence

CATTCACTCTGCACCAATCGAAACACACACTTCCTCCATTCAACATATATTAGTTGTCAGGTGTTTCAATCTTCTCCAAAAACAAAAGTTCTCTAAGTTT[A/G]
ACCAATTTTTTTTAAAAAGTAATTAACATCTATAATATCTAATCAACTCTAAAATTAAGCTTTAATTCAAATTTTCGCTGTGACTGATAAACTAAAAACC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.40%	33.50%	0.04%	0.00%	NA
All Indica	2759	98.80%	1.20%	0.04%	0.00%	NA
All Japonica	1512	6.50%	93.50%	0.00%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	98.10%	1.90%	0.00%	0.00%	NA
Indica III	913	98.90%	1.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.60%	1.30%	0.13%	0.00%	NA
Temperate Japonica	767	7.00%	93.00%	0.00%	0.00%	NA
Tropical Japonica	504	6.30%	93.70%	0.00%	0.00%	NA
Japonica Intermediate	241	5.40%	94.60%	0.00%	0.00%	NA
VI/Aromatic	96	5.20%	94.80%	0.00%	0.00%	NA
Intermediate	90	47.80%	51.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221010615	T -> C	LOC_Os02g35010.1	upstream_gene_variant ; 2206.0bp to feature; MODIFIER	silent_mutation	Average:45.325; most accessible tissue: Minghui63 root, score: 59.105	N	N	N	N
vg0221010615	T -> C	LOC_Os02g35020.1	downstream_gene_variant ; 3832.0bp to feature; MODIFIER	silent_mutation	Average:45.325; most accessible tissue: Minghui63 root, score: 59.105	N	N	N	N
vg0221010615	T -> C	LOC_Os02g35010-LOC_Os02g35020	intergenic_region ; MODIFIER	silent_mutation	Average:45.325; most accessible tissue: Minghui63 root, score: 59.105	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221010615	3.67E-07	NA	mr1101	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010615	NA	4.23E-17	mr1116	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010615	5.39E-06	NA	mr1150	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010615	5.75E-06	3.25E-20	mr1242	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010615	5.29E-06	NA	mr1242	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010615	9.81E-06	NA	mr1247	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010615	NA	2.15E-85	mr1504	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010615	NA	4.29E-09	mr1595	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010615	NA	1.69E-31	mr1647	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010615	NA	8.25E-21	mr1698	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010615	NA	2.33E-20	mr1754	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010615	NA	1.49E-19	mr1767	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010615	9.22E-06	2.16E-26	mr1917	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010615	NA	7.33E-100	mr1987	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010615	3.40E-06	NA	mr1098_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010615	6.32E-06	5.84E-06	mr1098_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010615	NA	1.14E-16	mr1114_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010615	6.15E-06	NA	mr1120_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010615	NA	9.49E-13	mr1128_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010615	NA	2.54E-15	mr1148_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010615	NA	1.53E-31	mr1150_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010615	NA	2.52E-18	mr1239_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010615	NA	1.64E-24	mr1242_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010615	NA	5.26E-13	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010615	NA	2.49E-18	mr1657_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251