\
| Variant ID: vg0221010615 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 21010615 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGTTTTTAGTTTATCAGTCACAGCGAAAATTTGAATTAAAGCTTAATTTTAGAGTTGATTAGATATTATAGATGTTAATTACTTTTTAAAAAAAATTGGT[T/C]
AAACTTAGAGAACTTTTGTTTTTGGAGAAGATTGAAACACCTGACAACTAATATATGTTGAATGGAGGAAGTGTGTGTTTCGATTGGTGCAGAGTGAATG
CATTCACTCTGCACCAATCGAAACACACACTTCCTCCATTCAACATATATTAGTTGTCAGGTGTTTCAATCTTCTCCAAAAACAAAAGTTCTCTAAGTTT[A/G]
ACCAATTTTTTTTAAAAAGTAATTAACATCTATAATATCTAATCAACTCTAAAATTAAGCTTTAATTCAAATTTTCGCTGTGACTGATAAACTAAAAACC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.40% | 33.50% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 98.80% | 1.20% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 6.50% | 93.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.60% | 1.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 7.00% | 93.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 6.30% | 93.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.40% | 94.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 47.80% | 51.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0221010615 | T -> C | LOC_Os02g35010.1 | upstream_gene_variant ; 2206.0bp to feature; MODIFIER | silent_mutation | Average:45.325; most accessible tissue: Minghui63 root, score: 59.105 | N | N | N | N |
| vg0221010615 | T -> C | LOC_Os02g35020.1 | downstream_gene_variant ; 3832.0bp to feature; MODIFIER | silent_mutation | Average:45.325; most accessible tissue: Minghui63 root, score: 59.105 | N | N | N | N |
| vg0221010615 | T -> C | LOC_Os02g35010-LOC_Os02g35020 | intergenic_region ; MODIFIER | silent_mutation | Average:45.325; most accessible tissue: Minghui63 root, score: 59.105 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0221010615 | 3.67E-07 | NA | mr1101 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221010615 | NA | 4.23E-17 | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221010615 | 5.39E-06 | NA | mr1150 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221010615 | 5.75E-06 | 3.25E-20 | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221010615 | 5.29E-06 | NA | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221010615 | 9.81E-06 | NA | mr1247 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221010615 | NA | 2.15E-85 | mr1504 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221010615 | NA | 4.29E-09 | mr1595 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221010615 | NA | 1.69E-31 | mr1647 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221010615 | NA | 8.25E-21 | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221010615 | NA | 2.33E-20 | mr1754 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221010615 | NA | 1.49E-19 | mr1767 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221010615 | 9.22E-06 | 2.16E-26 | mr1917 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221010615 | NA | 7.33E-100 | mr1987 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221010615 | 3.40E-06 | NA | mr1098_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221010615 | 6.32E-06 | 5.84E-06 | mr1098_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221010615 | NA | 1.14E-16 | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221010615 | 6.15E-06 | NA | mr1120_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221010615 | NA | 9.49E-13 | mr1128_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221010615 | NA | 2.54E-15 | mr1148_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221010615 | NA | 1.53E-31 | mr1150_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221010615 | NA | 2.52E-18 | mr1239_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221010615 | NA | 1.64E-24 | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221010615 | NA | 5.26E-13 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221010615 | NA | 2.49E-18 | mr1657_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |