Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221010404:

Variant ID: vg0221010404 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21010404
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, T: 0.05, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


CGACAGCCGAAGATTCAACGGAGAGTACTACAAGAAGGATCCTTCGCAGCGAATTCAGAAAGAATGGTGCGTAGAGAGGAGGTATATAGAGGTTGACAAT[G/T]
GACTTTGAGCATGTTCTTGGATGATTAATATAATAGTACTGTAATAGATTATAGATAATAGCTTATATAGATAAGTTATATATTATAAATTTTATGGCTT

Reverse complement sequence

AAGCCATAAAATTTATAATATATAACTTATCTATATAAGCTATTATCTATAATCTATTACAGTACTATTATATTAATCATCCAAGAACATGCTCAAAGTC[C/A]
ATTGTCAACCTCTATATACCTCCTCTCTACGCACCATTCTTTCTGAATTCGCTGCGAAGGATCCTTCTTGTAGTACTCTCCGTTGAATCTTCGGCTGTCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.90% 42.60% 0.49% 0.00% NA
All Indica  2759 38.40% 60.90% 0.72% 0.00% NA
All Japonica  1512 94.00% 6.00% 0.00% 0.00% NA
Aus  269 21.20% 78.10% 0.74% 0.00% NA
Indica I  595 21.30% 78.00% 0.67% 0.00% NA
Indica II  465 35.70% 63.90% 0.43% 0.00% NA
Indica III  913 56.80% 42.30% 0.88% 0.00% NA
Indica Intermediate  786 31.40% 67.80% 0.76% 0.00% NA
Temperate Japonica  767 93.20% 6.80% 0.00% 0.00% NA
Tropical Japonica  504 95.00% 5.00% 0.00% 0.00% NA
Japonica Intermediate  241 94.60% 5.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 64.40% 34.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221010404 G -> T LOC_Os02g35010.1 upstream_gene_variant ; 1995.0bp to feature; MODIFIER silent_mutation Average:67.51; most accessible tissue: Zhenshan97 root, score: 87.466 N N N N
vg0221010404 G -> T LOC_Os02g35020.1 downstream_gene_variant ; 4043.0bp to feature; MODIFIER silent_mutation Average:67.51; most accessible tissue: Zhenshan97 root, score: 87.466 N N N N
vg0221010404 G -> T LOC_Os02g35010-LOC_Os02g35020 intergenic_region ; MODIFIER silent_mutation Average:67.51; most accessible tissue: Zhenshan97 root, score: 87.466 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0221010404 G T 0.28 0.09 0.06 0.0 0.04 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221010404 4.66E-06 4.66E-06 mr1099 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010404 4.79E-08 2.74E-07 mr1101 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010404 3.12E-06 NA mr1150 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010404 NA 3.84E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010404 5.37E-06 NA mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010404 NA 1.21E-13 mr1441 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010404 NA 1.43E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010404 1.47E-06 9.71E-08 mr1098_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010404 NA 9.01E-06 mr1099_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010404 9.56E-06 2.55E-06 mr1150_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221010404 NA 9.65E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251