\
| Variant ID: vg0220988854 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 20988854 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AACAATAACCCACTCGTGCCGGCTTGTGTTGCGTCGTCTGTCCGCCCCTCTTGGTTCCTAACAGCAAGTCCAGGCATCGCCTCACTCCAGGTGGCTGGCC[G/A]
AGCAAGTATGCTCAGTTCATAGATTTTGGTATTCAGGTGTATATGTTCTGCAATAGAAAGTTTACAAAGAATGCAAAATTACGAAGGGTAGGACGCAAAC
GTTTGCGTCCTACCCTTCGTAATTTTGCATTCTTTGTAAACTTTCTATTGCAGAACATATACACCTGAATACCAAAATCTATGAACTGAGCATACTTGCT[C/T]
GGCCAGCCACCTGGAGTGAGGCGATGCCTGGACTTGCTGTTAGGAACCAAGAGGGGCGGACAGACGACGCAACACAAGCCGGCACGAGTGGGTTATTGTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.50% | 12.50% | 8.04% | 0.00% | NA |
| All Indica | 2759 | 67.10% | 19.60% | 13.34% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 82.90% | 13.40% | 3.72% | 0.00% | NA |
| Indica I | 595 | 81.80% | 12.60% | 5.55% | 0.00% | NA |
| Indica II | 465 | 67.10% | 20.40% | 12.47% | 0.00% | NA |
| Indica III | 913 | 54.70% | 24.80% | 20.59% | 0.00% | NA |
| Indica Intermediate | 786 | 70.40% | 18.30% | 11.32% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 6.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0220988854 | G -> A | LOC_Os02g34990.1 | upstream_gene_variant ; 819.0bp to feature; MODIFIER | silent_mutation | Average:29.933; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0220988854 | G -> A | LOC_Os02g34990.2 | intron_variant ; MODIFIER | silent_mutation | Average:29.933; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0220988854 | 6.46E-06 | NA | mr1084 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220988854 | 2.07E-07 | 1.24E-07 | mr1084 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220988854 | NA | 2.57E-06 | mr1106 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220988854 | NA | 3.83E-06 | mr1347 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220988854 | NA | 1.50E-07 | mr1347 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220988854 | NA | 3.47E-06 | mr1441 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220988854 | 9.21E-06 | 9.21E-06 | mr1492 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220988854 | 9.01E-06 | 6.75E-07 | mr1641 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220988854 | NA | 6.75E-06 | mr1839 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220988854 | 2.54E-06 | 2.53E-06 | mr1869 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220988854 | 1.25E-06 | 1.25E-06 | mr1869 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |