\
| Variant ID: vg0220960867 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 20960867 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAATTAAAAAACAAAAAATCAAATGTACTTAAAAAAGTAAATGCTATTTATAATAAAAAACCAAAAATTCAAATGTAAAATTAAATTTTAGTCTCCCATC[G/A]
TTTGGCTCTTTCCCTAATAAGCCAAAACAGCTTATTAGGGGATAAAAATAAATTTATAGATAAAACTTTCATATATATATATATGTTCTTGATGACTTAA
TTAAGTCATCAAGAACATATATATATATATGAAAGTTTTATCTATAAATTTATTTTTATCCCCTAATAAGCTGTTTTGGCTTATTAGGGAAAGAGCCAAA[C/T]
GATGGGAGACTAAAATTTAATTTTACATTTGAATTTTTGGTTTTTTATTATAAATAGCATTTACTTTTTTAAGTACATTTGATTTTTTGTTTTTTAATTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.80% | 1.90% | 1.61% | 1.71% | NA |
| All Indica | 2759 | 94.20% | 0.60% | 2.43% | 2.75% | NA |
| All Japonica | 1512 | 95.30% | 4.40% | 0.26% | 0.07% | NA |
| Aus | 269 | 98.50% | 0.70% | 0.00% | 0.74% | NA |
| Indica I | 595 | 95.50% | 0.00% | 3.19% | 1.34% | NA |
| Indica II | 465 | 94.00% | 0.90% | 3.23% | 1.94% | NA |
| Indica III | 913 | 94.30% | 0.90% | 1.31% | 3.50% | NA |
| Indica Intermediate | 786 | 93.30% | 0.60% | 2.67% | 3.44% | NA |
| Temperate Japonica | 767 | 94.90% | 4.80% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 94.80% | 5.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 1.70% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 3.30% | 5.56% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0220960867 | G -> A | LOC_Os02g34930.1 | downstream_gene_variant ; 4582.0bp to feature; MODIFIER | silent_mutation | Average:36.548; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0220960867 | G -> A | LOC_Os02g34950.1 | downstream_gene_variant ; 2071.0bp to feature; MODIFIER | silent_mutation | Average:36.548; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0220960867 | G -> A | LOC_Os02g34940.1 | intron_variant ; MODIFIER | silent_mutation | Average:36.548; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0220960867 | G -> A | LOC_Os02g34940.2 | intron_variant ; MODIFIER | silent_mutation | Average:36.548; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0220960867 | G -> DEL | N | N | silent_mutation | Average:36.548; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0220960867 | 5.10E-06 | 1.71E-07 | mr1069 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220960867 | 1.36E-06 | 1.36E-06 | mr1099 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220960867 | 4.35E-07 | 3.14E-07 | mr1101 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220960867 | 6.96E-07 | 6.32E-07 | mr1150 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220960867 | NA | 4.00E-06 | mr1441 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220960867 | 8.31E-07 | 8.31E-07 | mr1595 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220960867 | 7.04E-06 | 7.04E-06 | mr1861 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220960867 | NA | 5.01E-06 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220960867 | 4.52E-06 | 9.83E-08 | mr1098_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220960867 | NA | 9.43E-06 | mr1099_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220960867 | NA | 3.92E-07 | mr1150_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |