\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220960867:

Variant ID: vg0220960867 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 20960867
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAATTAAAAAACAAAAAATCAAATGTACTTAAAAAAGTAAATGCTATTTATAATAAAAAACCAAAAATTCAAATGTAAAATTAAATTTTAGTCTCCCATC[G/A]
TTTGGCTCTTTCCCTAATAAGCCAAAACAGCTTATTAGGGGATAAAAATAAATTTATAGATAAAACTTTCATATATATATATATGTTCTTGATGACTTAA

Reverse complement sequence

TTAAGTCATCAAGAACATATATATATATATGAAAGTTTTATCTATAAATTTATTTTTATCCCCTAATAAGCTGTTTTGGCTTATTAGGGAAAGAGCCAAA[C/T]
GATGGGAGACTAAAATTTAATTTTACATTTGAATTTTTGGTTTTTTATTATAAATAGCATTTACTTTTTTAAGTACATTTGATTTTTTGTTTTTTAATTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.80% 1.90% 1.61% 1.71% NA
All Indica  2759 94.20% 0.60% 2.43% 2.75% NA
All Japonica  1512 95.30% 4.40% 0.26% 0.07% NA
Aus  269 98.50% 0.70% 0.00% 0.74% NA
Indica I  595 95.50% 0.00% 3.19% 1.34% NA
Indica II  465 94.00% 0.90% 3.23% 1.94% NA
Indica III  913 94.30% 0.90% 1.31% 3.50% NA
Indica Intermediate  786 93.30% 0.60% 2.67% 3.44% NA
Temperate Japonica  767 94.90% 4.80% 0.26% 0.00% NA
Tropical Japonica  504 94.80% 5.00% 0.20% 0.00% NA
Japonica Intermediate  241 97.50% 1.70% 0.41% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 3.30% 5.56% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0220960867 G -> A LOC_Os02g34930.1 downstream_gene_variant ; 4582.0bp to feature; MODIFIER silent_mutation Average:36.548; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0220960867 G -> A LOC_Os02g34950.1 downstream_gene_variant ; 2071.0bp to feature; MODIFIER silent_mutation Average:36.548; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0220960867 G -> A LOC_Os02g34940.1 intron_variant ; MODIFIER silent_mutation Average:36.548; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0220960867 G -> A LOC_Os02g34940.2 intron_variant ; MODIFIER silent_mutation Average:36.548; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0220960867 G -> DEL N N silent_mutation Average:36.548; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0220960867 5.10E-06 1.71E-07 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220960867 1.36E-06 1.36E-06 mr1099 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220960867 4.35E-07 3.14E-07 mr1101 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220960867 6.96E-07 6.32E-07 mr1150 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220960867 NA 4.00E-06 mr1441 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220960867 8.31E-07 8.31E-07 mr1595 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220960867 7.04E-06 7.04E-06 mr1861 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220960867 NA 5.01E-06 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220960867 4.52E-06 9.83E-08 mr1098_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220960867 NA 9.43E-06 mr1099_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220960867 NA 3.92E-07 mr1150_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251