| Variant ID: vg0220950949 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 20950949 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 291. )
GGTAAGTAGTCATCTGTGACGGGCTCTAGTTTAGACCCGATTGAGATGAGTATCATCTGTGATGTGCTCTAGTGTAGGCCCGATTGAGGTTAGTAGTCAT[C/T]
TGTGACGGGCGCTAGTTGTGGCCCGATTGAGATAGGTCATCTGTGATGGGCTATAGTTTGACTGGTCGTCTGGGTCAAAGCTATCGGTGGCGGGTTCATC
GATGAACCCGCCACCGATAGCTTTGACCCAGACGACCAGTCAAACTATAGCCCATCACAGATGACCTATCTCAATCGGGCCACAACTAGCGCCCGTCACA[G/A]
ATGACTACTAACCTCAATCGGGCCTACACTAGAGCACATCACAGATGATACTCATCTCAATCGGGTCTAAACTAGAGCCCGTCACAGATGACTACTTACC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 90.90% | 9.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0220950949 | C -> T | LOC_Os02g34910.1 | upstream_gene_variant ; 2858.0bp to feature; MODIFIER | silent_mutation | Average:56.555; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg0220950949 | C -> T | LOC_Os02g34930.1 | upstream_gene_variant ; 4270.0bp to feature; MODIFIER | silent_mutation | Average:56.555; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg0220950949 | C -> T | LOC_Os02g34900.1 | downstream_gene_variant ; 4717.0bp to feature; MODIFIER | silent_mutation | Average:56.555; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg0220950949 | C -> T | LOC_Os02g34920.1 | intron_variant ; MODIFIER | silent_mutation | Average:56.555; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0220950949 | NA | 1.43E-06 | mr1069 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220950949 | NA | 1.90E-06 | mr1101 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220950949 | 4.60E-06 | 5.51E-07 | mr1150 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220950949 | 8.26E-07 | 8.26E-07 | mr1200 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220950949 | NA | 1.16E-06 | mr1441 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220950949 | 2.30E-06 | 2.30E-06 | mr1861 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |