\
| Variant ID: vg0220941661 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 20941661 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 222. )
GCCTTCTCGGTGAGGTCATCCGCGTTTCGACAAGGGTGATAACCAGAGGAGATGTGGTGCTGCGATTGCGGGGCTCAAGAGCGTGCGCGTTCAAGAAGCC[G/A]
GATCGATTTGTGTCGCGACTCCACCCAAATCGTTGTTTATCAGAACCTTTCGGAAGATCAGGAACCCTAGTGCACATCAAATGGATTCACATATGCATGC
GCATGCATATGTGAATCCATTTGATGTGCACTAGGGTTCCTGATCTTCCGAAAGGTTCTGATAAACAACGATTTGGGTGGAGTCGCGACACAAATCGATC[C/T]
GGCTTCTTGAACGCGCACGCTCTTGAGCCCCGCAATCGCAGCACCACATCTCCTCTGGTTATCACCCTTGTCGAAACGCGGATGACCTCACCGAGAAGGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.10% | 8.80% | 1.06% | 0.97% | NA |
| All Indica | 2759 | 88.80% | 10.10% | 0.54% | 0.54% | NA |
| All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 28.30% | 48.00% | 12.27% | 11.52% | NA |
| Indica I | 595 | 90.10% | 9.60% | 0.17% | 0.17% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 84.40% | 14.20% | 0.44% | 0.88% | NA |
| Indica Intermediate | 786 | 87.00% | 10.90% | 1.27% | 0.76% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 5.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0220941661 | G -> A | LOC_Os02g34900.1 | intron_variant ; MODIFIER | silent_mutation | Average:41.46; most accessible tissue: Minghui63 young leaf, score: 63.571 | N | N | N | N |
| vg0220941661 | G -> DEL | N | N | silent_mutation | Average:41.46; most accessible tissue: Minghui63 young leaf, score: 63.571 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0220941661 | NA | 3.77E-07 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941661 | NA | 5.87E-08 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941661 | NA | 6.32E-08 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941661 | NA | 6.62E-06 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941661 | NA | 8.07E-16 | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941661 | 1.77E-06 | 1.13E-07 | mr1496 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941661 | NA | 6.39E-13 | mr1918 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941661 | NA | 3.91E-06 | mr1921 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941661 | NA | 1.39E-06 | mr1006_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941661 | 2.41E-06 | 2.06E-07 | mr1123_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941661 | 1.57E-06 | NA | mr1242_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941661 | NA | 1.71E-09 | mr1327_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941661 | NA | 3.91E-14 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941661 | 1.16E-07 | 9.47E-09 | mr1496_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941661 | NA | 7.85E-09 | mr1627_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941661 | NA | 3.78E-06 | mr1929_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |