\
| Variant ID: vg0220941584 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 20941584 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 313. )
CTTAATCATTCATATGCAATTTTGGTTGTTTTCTATCTCGTTCTTGTTTGTGTTCTTCGATTGGCAAACAGGGATTAGCCTTCTCGGTGAGGTCATCCGC[G/A]
TTTCGACAAGGGTGATAACCAGAGGAGATGTGGTGCTGCGATTGCGGGGCTCAAGAGCGTGCGCGTTCAAGAAGCCGGATCGATTTGTGTCGCGACTCCA
TGGAGTCGCGACACAAATCGATCCGGCTTCTTGAACGCGCACGCTCTTGAGCCCCGCAATCGCAGCACCACATCTCCTCTGGTTATCACCCTTGTCGAAA[C/T]
GCGGATGACCTCACCGAGAAGGCTAATCCCTGTTTGCCAATCGAAGAACACAAACAAGAACGAGATAGAAAACAACCAAAATTGCATATGAATGATTAAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 90.90% | 9.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0220941584 | G -> A | LOC_Os02g34900.1 | intron_variant ; MODIFIER | silent_mutation | Average:41.693; most accessible tissue: Minghui63 young leaf, score: 68.07 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0220941584 | NA | 9.27E-06 | mr1247 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941584 | NA | 1.88E-06 | mr1441 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941584 | 9.68E-07 | 9.68E-07 | mr1861 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941584 | 2.17E-06 | 2.17E-06 | mr1186_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941584 | NA | 3.92E-06 | mr1267_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941584 | 3.36E-06 | 3.36E-06 | mr1445_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941584 | 6.17E-06 | 6.17E-06 | mr1616_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941584 | 8.43E-06 | 8.43E-06 | mr1647_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941584 | 2.81E-06 | 2.81E-06 | mr1655_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941584 | 1.16E-06 | 1.16E-06 | mr1669_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941584 | NA | 1.92E-06 | mr1851_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941584 | NA | 8.25E-06 | mr1861_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |