\
| Variant ID: vg0220941121 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 20941121 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 291. )
CGGTGTGTTCGATTTTTTCGTCAACACGAGGACGTCCAAGTCAAGGTGGAGGCCCAAACCAATTTGACCTCGGGTGCAATTCGGAGTCCAGGACCAGTCT[G/A,T]
CACTAAAACAGGCGCCCAGGTCGCATACGTGCTCGCATTGGGGCGTTCTTTATATGGATGGAAAGCTAAGAAGATAACATTTCCAATGGTTCTGGTCCCA
TGGGACCAGAACCATTGGAAATGTTATCTTCTTAGCTTTCCATCCATATAAAGAACGCCCCAATGCGAGCACGTATGCGACCTGGGCGCCTGTTTTAGTG[C/T,A]
AGACTGGTCCTGGACTCCGAATTGCACCCGAGGTCAAATTGGTTTGGGCCTCCACCTTGACTTGGACGTCCTCGTGTTGACGAAAAAATCGAACACACCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.90% | 4.00% | 0.02% | 0.00% | T: 0.04% |
| All Indica | 2759 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 92.70% | 7.10% | 0.00% | 0.00% | T: 0.13% |
| Aus | 269 | 78.80% | 20.80% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 90.90% | 9.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 93.70% | 6.00% | 0.00% | 0.00% | T: 0.40% |
| Japonica Intermediate | 241 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0220941121 | G -> A | LOC_Os02g34900.1 | intron_variant ; MODIFIER | silent_mutation | Average:44.1; most accessible tissue: Minghui63 young leaf, score: 69.4 | N | N | N | N |
| vg0220941121 | G -> T | LOC_Os02g34900.1 | intron_variant ; MODIFIER | silent_mutation | Average:44.1; most accessible tissue: Minghui63 young leaf, score: 69.4 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0220941121 | NA | 9.70E-06 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941121 | NA | 4.36E-06 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941121 | NA | 2.75E-06 | mr1150 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941121 | NA | 5.42E-06 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941121 | NA | 1.19E-06 | mr1247 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941121 | 4.98E-06 | 4.98E-06 | mr1861 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941121 | 7.46E-06 | 4.30E-07 | mr1186_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941121 | 3.93E-06 | 3.22E-06 | mr1265_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941121 | NA | 3.94E-06 | mr1267_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941121 | NA | 1.44E-07 | mr1360_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941121 | 6.85E-06 | NA | mr1794_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220941121 | 5.07E-06 | 4.51E-09 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |