\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220933168:

Variant ID: vg0220933168 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 20933168
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.69, A: 0.31, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


ATATCTGTGAGTTGGCAGTAAGGTGGGGTCCATGGGGTAATAAAAATCGTAGCAAGGACAGAGCATGCATGCAACGGTTGGGAGAAGCAATGCTTTTGCT[G/A]
TCAGAAAACACTGTGTACATGCATATTCTATTTCCTTGCTTCCGGCAGTAGGGGTATGACCCGGTTGTAGTTATGTACTAGCCCCACAATGCTTAATACC

Reverse complement sequence

GGTATTAAGCATTGTGGGGCTAGTACATAACTACAACCGGGTCATACCCCTACTGCCGGAAGCAAGGAAATAGAATATGCATGTACACAGTGTTTTCTGA[C/T]
AGCAAAAGCATTGCTTCTCCCAACCGTTGCATGCATGCTCTGTCCTTGCTACGATTTTTATTACCCCATGGACCCCACCTTACTGCCAACTCACAGATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.20% 11.40% 1.33% 22.13% NA
All Indica  2759 48.70% 11.90% 2.25% 37.19% NA
All Japonica  1512 99.30% 0.20% 0.00% 0.53% NA
Aus  269 26.80% 73.20% 0.00% 0.00% NA
Indica I  595 33.30% 10.80% 3.03% 52.94% NA
Indica II  465 48.60% 1.50% 2.15% 47.74% NA
Indica III  913 60.60% 16.20% 0.55% 22.67% NA
Indica Intermediate  786 46.60% 13.90% 3.69% 35.88% NA
Temperate Japonica  767 99.20% 0.10% 0.00% 0.65% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 0.40% 0.00% 1.24% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 81.10% 4.40% 1.11% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0220933168 G -> A LOC_Os02g34884.1 upstream_gene_variant ; 362.0bp to feature; MODIFIER silent_mutation Average:78.953; most accessible tissue: Zhenshan97 flower, score: 90.915 N N N N
vg0220933168 G -> A LOC_Os02g34900.1 upstream_gene_variant ; 4991.0bp to feature; MODIFIER silent_mutation Average:78.953; most accessible tissue: Zhenshan97 flower, score: 90.915 N N N N
vg0220933168 G -> A LOC_Os02g34884-LOC_Os02g34900 intergenic_region ; MODIFIER silent_mutation Average:78.953; most accessible tissue: Zhenshan97 flower, score: 90.915 N N N N
vg0220933168 G -> DEL N N silent_mutation Average:78.953; most accessible tissue: Zhenshan97 flower, score: 90.915 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0220933168 G A -0.02 -0.01 -0.02 -0.05 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0220933168 NA 4.89E-06 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220933168 NA 7.60E-07 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220933168 NA 8.12E-07 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220933168 NA 6.91E-28 mr1101 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220933168 NA 6.49E-12 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220933168 NA 2.20E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220933168 NA 1.02E-18 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220933168 6.57E-07 3.49E-08 mr1496 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220933168 NA 1.41E-21 mr1589 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220933168 NA 1.52E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220933168 NA 5.31E-28 mr1868 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220933168 NA 2.84E-06 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220933168 NA 9.97E-15 mr1918 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220933168 NA 9.35E-06 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220933168 NA 5.29E-26 mr1099_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220933168 NA 8.14E-06 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220933168 NA 5.37E-22 mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220933168 NA 9.11E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220933168 NA 6.94E-07 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220933168 NA 2.32E-08 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220933168 NA 3.76E-15 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220933168 9.37E-06 1.33E-07 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220933168 NA 2.33E-12 mr1918_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220933168 NA 4.95E-07 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251