\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220855179:

Variant ID: vg0220855179 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 20855179
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


TGGATCGGAACGGGGTGGATCGCTCCAAAATATTGTATTGAGGTGGAGCGGCGAAAATGTAGCTCCACGGCTCCACTCCGAAAATAATTACAGCACTACC[C/T]
ATTCCTTTTCACTGAAGTTATAGGAAAATGCCACCACTCTACCCCCTTCGATTCCCTCCCGCATTGGGCGAGCGACGCATTCCCAACCCCTTCCTCGCCC

Reverse complement sequence

GGGCGAGGAAGGGGTTGGGAATGCGTCGCTCGCCCAATGCGGGAGGGAATCGAAGGGGGTAGAGTGGTGGCATTTTCCTATAACTTCAGTGAAAAGGAAT[G/A]
GGTAGTGCTGTAATTATTTTCGGAGTGGAGCCGTGGAGCTACATTTTCGCCGCTCCACCTCAATACAATATTTTGGAGCGATCCACCCCGTTCCGATCCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.70% 46.30% 0.15% 1.86% NA
All Indica  2759 84.80% 12.00% 0.18% 3.08% NA
All Japonica  1512 1.10% 98.80% 0.07% 0.00% NA
Aus  269 21.60% 78.10% 0.00% 0.37% NA
Indica I  595 97.10% 0.50% 0.17% 2.18% NA
Indica II  465 69.00% 29.90% 0.22% 0.86% NA
Indica III  913 89.70% 9.00% 0.00% 1.31% NA
Indica Intermediate  786 79.00% 13.50% 0.38% 7.12% NA
Temperate Japonica  767 0.90% 99.00% 0.13% 0.00% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 0.00% 100.00% 0.00% 0.00% NA
Intermediate  90 30.00% 66.70% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0220855179 C -> T LOC_Os02g34770.1 upstream_gene_variant ; 4029.0bp to feature; MODIFIER silent_mutation Average:53.033; most accessible tissue: Zhenshan97 young leaf, score: 71.497 N N N N
vg0220855179 C -> T LOC_Os02g34780.1 upstream_gene_variant ; 2121.0bp to feature; MODIFIER silent_mutation Average:53.033; most accessible tissue: Zhenshan97 young leaf, score: 71.497 N N N N
vg0220855179 C -> T LOC_Os02g34790.1 downstream_gene_variant ; 1865.0bp to feature; MODIFIER silent_mutation Average:53.033; most accessible tissue: Zhenshan97 young leaf, score: 71.497 N N N N
vg0220855179 C -> T LOC_Os02g34780-LOC_Os02g34790 intergenic_region ; MODIFIER silent_mutation Average:53.033; most accessible tissue: Zhenshan97 young leaf, score: 71.497 N N N N
vg0220855179 C -> DEL N N silent_mutation Average:53.033; most accessible tissue: Zhenshan97 young leaf, score: 71.497 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0220855179 NA 2.36E-12 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220855179 NA 1.68E-06 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220855179 NA 5.59E-11 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220855179 NA 7.14E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220855179 4.99E-06 NA mr1765 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220855179 6.34E-06 4.66E-07 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251