Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220855179:

Variant ID: vg0220855179 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 20855179
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:

TGGATCGGAACGGGGTGGATCGCTCCAAAATATTGTATTGAGGTGGAGCGGCGAAAATGTAGCTCCACGGCTCCACTCCGAAAATAATTACAGCACTACC[C/T]
ATTCCTTTTCACTGAAGTTATAGGAAAATGCCACCACTCTACCCCCTTCGATTCCCTCCCGCATTGGGCGAGCGACGCATTCCCAACCCCTTCCTCGCCC

Reverse complement sequence

GGGCGAGGAAGGGGTTGGGAATGCGTCGCTCGCCCAATGCGGGAGGGAATCGAAGGGGGTAGAGTGGTGGCATTTTCCTATAACTTCAGTGAAAAGGAAT[G/A]
GGTAGTGCTGTAATTATTTTCGGAGTGGAGCCGTGGAGCTACATTTTCGCCGCTCCACCTCAATACAATATTTTGGAGCGATCCACCCCGTTCCGATCCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.70%	46.30%	0.15%	1.86%	NA
All Indica	2759	84.80%	12.00%	0.18%	3.08%	NA
All Japonica	1512	1.10%	98.80%	0.07%	0.00%	NA
Aus	269	21.60%	78.10%	0.00%	0.37%	NA
Indica I	595	97.10%	0.50%	0.17%	2.18%	NA
Indica II	465	69.00%	29.90%	0.22%	0.86%	NA
Indica III	913	89.70%	9.00%	0.00%	1.31%	NA
Indica Intermediate	786	79.00%	13.50%	0.38%	7.12%	NA
Temperate Japonica	767	0.90%	99.00%	0.13%	0.00%	NA
Tropical Japonica	504	0.40%	99.60%	0.00%	0.00%	NA
Japonica Intermediate	241	3.30%	96.70%	0.00%	0.00%	NA
VI/Aromatic	96	0.00%	100.00%	0.00%	0.00%	NA
Intermediate	90	30.00%	66.70%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0220855179	C -> T	LOC_Os02g34770.1	upstream_gene_variant ; 4029.0bp to feature; MODIFIER	silent_mutation	Average:53.033; most accessible tissue: Zhenshan97 young leaf, score: 71.497	N	N	N	N
vg0220855179	C -> T	LOC_Os02g34780.1	upstream_gene_variant ; 2121.0bp to feature; MODIFIER	silent_mutation	Average:53.033; most accessible tissue: Zhenshan97 young leaf, score: 71.497	N	N	N	N
vg0220855179	C -> T	LOC_Os02g34790.1	downstream_gene_variant ; 1865.0bp to feature; MODIFIER	silent_mutation	Average:53.033; most accessible tissue: Zhenshan97 young leaf, score: 71.497	N	N	N	N
vg0220855179	C -> T	LOC_Os02g34780-LOC_Os02g34790	intergenic_region ; MODIFIER	silent_mutation	Average:53.033; most accessible tissue: Zhenshan97 young leaf, score: 71.497	N	N	N	N
vg0220855179	C -> DEL	N	N	silent_mutation	Average:53.033; most accessible tissue: Zhenshan97 young leaf, score: 71.497	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0220855179	NA	2.36E-12	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220855179	NA	1.68E-06	mr1347	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220855179	NA	5.59E-11	mr1609	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220855179	NA	7.14E-07	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220855179	4.99E-06	NA	mr1765	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220855179	6.34E-06	4.66E-07	mr1917	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251