\
| Variant ID: vg0220855179 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 20855179 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 77. )
TGGATCGGAACGGGGTGGATCGCTCCAAAATATTGTATTGAGGTGGAGCGGCGAAAATGTAGCTCCACGGCTCCACTCCGAAAATAATTACAGCACTACC[C/T]
ATTCCTTTTCACTGAAGTTATAGGAAAATGCCACCACTCTACCCCCTTCGATTCCCTCCCGCATTGGGCGAGCGACGCATTCCCAACCCCTTCCTCGCCC
GGGCGAGGAAGGGGTTGGGAATGCGTCGCTCGCCCAATGCGGGAGGGAATCGAAGGGGGTAGAGTGGTGGCATTTTCCTATAACTTCAGTGAAAAGGAAT[G/A]
GGTAGTGCTGTAATTATTTTCGGAGTGGAGCCGTGGAGCTACATTTTCGCCGCTCCACCTCAATACAATATTTTGGAGCGATCCACCCCGTTCCGATCCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.70% | 46.30% | 0.15% | 1.86% | NA |
| All Indica | 2759 | 84.80% | 12.00% | 0.18% | 3.08% | NA |
| All Japonica | 1512 | 1.10% | 98.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 21.60% | 78.10% | 0.00% | 0.37% | NA |
| Indica I | 595 | 97.10% | 0.50% | 0.17% | 2.18% | NA |
| Indica II | 465 | 69.00% | 29.90% | 0.22% | 0.86% | NA |
| Indica III | 913 | 89.70% | 9.00% | 0.00% | 1.31% | NA |
| Indica Intermediate | 786 | 79.00% | 13.50% | 0.38% | 7.12% | NA |
| Temperate Japonica | 767 | 0.90% | 99.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.30% | 96.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 30.00% | 66.70% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0220855179 | C -> T | LOC_Os02g34770.1 | upstream_gene_variant ; 4029.0bp to feature; MODIFIER | silent_mutation | Average:53.033; most accessible tissue: Zhenshan97 young leaf, score: 71.497 | N | N | N | N |
| vg0220855179 | C -> T | LOC_Os02g34780.1 | upstream_gene_variant ; 2121.0bp to feature; MODIFIER | silent_mutation | Average:53.033; most accessible tissue: Zhenshan97 young leaf, score: 71.497 | N | N | N | N |
| vg0220855179 | C -> T | LOC_Os02g34790.1 | downstream_gene_variant ; 1865.0bp to feature; MODIFIER | silent_mutation | Average:53.033; most accessible tissue: Zhenshan97 young leaf, score: 71.497 | N | N | N | N |
| vg0220855179 | C -> T | LOC_Os02g34780-LOC_Os02g34790 | intergenic_region ; MODIFIER | silent_mutation | Average:53.033; most accessible tissue: Zhenshan97 young leaf, score: 71.497 | N | N | N | N |
| vg0220855179 | C -> DEL | N | N | silent_mutation | Average:53.033; most accessible tissue: Zhenshan97 young leaf, score: 71.497 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0220855179 | NA | 2.36E-12 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220855179 | NA | 1.68E-06 | mr1347 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220855179 | NA | 5.59E-11 | mr1609 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220855179 | NA | 7.14E-07 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220855179 | 4.99E-06 | NA | mr1765 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220855179 | 6.34E-06 | 4.66E-07 | mr1917 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |