Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220854116:

Variant ID: vg0220854116 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 20854116
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

GGTTGTCGGCTAGTATAATTAGCAATAGATTGGGAGCCCATACATTCCCGATTACTCGTTGTTCTTCTTGCATCGGCGGTGGACCTTCCCGATTACTCTA[G/A]
GAGCAGGTACAATAGAATTGTTTTATTAGATGCAAAAATACCATGTTAGATTGTTTGGTGCTTTCAAAGAGAGAAGAGAGAGAAGGAATGCAGGCCACAA

Reverse complement sequence

TTGTGGCCTGCATTCCTTCTCTCTCTTCTCTCTTTGAAAGCACCAAACAATCTAACATGGTATTTTTGCATCTAATAAAACAATTCTATTGTACCTGCTC[C/T]
TAGAGTAATCGGGAAGGTCCACCGCCGATGCAAGAAGAACAACGAGTAATCGGGAATGTATGGGCTCCCAATCTATTGCTAATTATACTAGCCGACAACC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.50%	10.20%	0.34%	0.00%	NA
All Indica	2759	88.70%	10.90%	0.47%	0.00%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	38.30%	61.30%	0.37%	0.00%	NA
Indica I	595	97.80%	2.20%	0.00%	0.00%	NA
Indica II	465	72.70%	26.50%	0.86%	0.00%	NA
Indica III	913	93.80%	6.20%	0.00%	0.00%	NA
Indica Intermediate	786	85.20%	13.60%	1.15%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.00%	1.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	90.00%	7.80%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0220854116	G -> A	LOC_Os02g34770.1	upstream_gene_variant ; 2966.0bp to feature; MODIFIER	silent_mutation	Average:64.074; most accessible tissue: Callus, score: 83.425	N	N	N	N
vg0220854116	G -> A	LOC_Os02g34780.1	upstream_gene_variant ; 1058.0bp to feature; MODIFIER	silent_mutation	Average:64.074; most accessible tissue: Callus, score: 83.425	N	N	N	N
vg0220854116	G -> A	LOC_Os02g34790.1	downstream_gene_variant ; 2928.0bp to feature; MODIFIER	silent_mutation	Average:64.074; most accessible tissue: Callus, score: 83.425	N	N	N	N
vg0220854116	G -> A	LOC_Os02g34780-LOC_Os02g34790	intergenic_region ; MODIFIER	silent_mutation	Average:64.074; most accessible tissue: Callus, score: 83.425	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0220854116	NA	1.41E-18	mr1114	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220854116	NA	4.46E-07	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220854116	NA	3.04E-16	mr1116	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220854116	NA	1.39E-06	mr1422	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220854116	5.75E-06	5.72E-06	mr1869	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220854116	1.09E-06	NA	mr1917	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220854116	5.46E-07	6.90E-08	mr1917	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220854116	8.84E-06	NA	mr1936	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251