\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220854116:

Variant ID: vg0220854116 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 20854116
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


GGTTGTCGGCTAGTATAATTAGCAATAGATTGGGAGCCCATACATTCCCGATTACTCGTTGTTCTTCTTGCATCGGCGGTGGACCTTCCCGATTACTCTA[G/A]
GAGCAGGTACAATAGAATTGTTTTATTAGATGCAAAAATACCATGTTAGATTGTTTGGTGCTTTCAAAGAGAGAAGAGAGAGAAGGAATGCAGGCCACAA

Reverse complement sequence

TTGTGGCCTGCATTCCTTCTCTCTCTTCTCTCTTTGAAAGCACCAAACAATCTAACATGGTATTTTTGCATCTAATAAAACAATTCTATTGTACCTGCTC[C/T]
TAGAGTAATCGGGAAGGTCCACCGCCGATGCAAGAAGAACAACGAGTAATCGGGAATGTATGGGCTCCCAATCTATTGCTAATTATACTAGCCGACAACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.50% 10.20% 0.34% 0.00% NA
All Indica  2759 88.70% 10.90% 0.47% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 38.30% 61.30% 0.37% 0.00% NA
Indica I  595 97.80% 2.20% 0.00% 0.00% NA
Indica II  465 72.70% 26.50% 0.86% 0.00% NA
Indica III  913 93.80% 6.20% 0.00% 0.00% NA
Indica Intermediate  786 85.20% 13.60% 1.15% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 90.00% 7.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0220854116 G -> A LOC_Os02g34770.1 upstream_gene_variant ; 2966.0bp to feature; MODIFIER silent_mutation Average:64.074; most accessible tissue: Callus, score: 83.425 N N N N
vg0220854116 G -> A LOC_Os02g34780.1 upstream_gene_variant ; 1058.0bp to feature; MODIFIER silent_mutation Average:64.074; most accessible tissue: Callus, score: 83.425 N N N N
vg0220854116 G -> A LOC_Os02g34790.1 downstream_gene_variant ; 2928.0bp to feature; MODIFIER silent_mutation Average:64.074; most accessible tissue: Callus, score: 83.425 N N N N
vg0220854116 G -> A LOC_Os02g34780-LOC_Os02g34790 intergenic_region ; MODIFIER silent_mutation Average:64.074; most accessible tissue: Callus, score: 83.425 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0220854116 NA 1.41E-18 mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220854116 NA 4.46E-07 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220854116 NA 3.04E-16 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220854116 NA 1.39E-06 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220854116 5.75E-06 5.72E-06 mr1869 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220854116 1.09E-06 NA mr1917 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220854116 5.46E-07 6.90E-08 mr1917 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220854116 8.84E-06 NA mr1936 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251