\
| Variant ID: vg0220854116 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 20854116 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 82. )
GGTTGTCGGCTAGTATAATTAGCAATAGATTGGGAGCCCATACATTCCCGATTACTCGTTGTTCTTCTTGCATCGGCGGTGGACCTTCCCGATTACTCTA[G/A]
GAGCAGGTACAATAGAATTGTTTTATTAGATGCAAAAATACCATGTTAGATTGTTTGGTGCTTTCAAAGAGAGAAGAGAGAGAAGGAATGCAGGCCACAA
TTGTGGCCTGCATTCCTTCTCTCTCTTCTCTCTTTGAAAGCACCAAACAATCTAACATGGTATTTTTGCATCTAATAAAACAATTCTATTGTACCTGCTC[C/T]
TAGAGTAATCGGGAAGGTCCACCGCCGATGCAAGAAGAACAACGAGTAATCGGGAATGTATGGGCTCCCAATCTATTGCTAATTATACTAGCCGACAACC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.50% | 10.20% | 0.34% | 0.00% | NA |
| All Indica | 2759 | 88.70% | 10.90% | 0.47% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 38.30% | 61.30% | 0.37% | 0.00% | NA |
| Indica I | 595 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 72.70% | 26.50% | 0.86% | 0.00% | NA |
| Indica III | 913 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 85.20% | 13.60% | 1.15% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 7.80% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0220854116 | G -> A | LOC_Os02g34770.1 | upstream_gene_variant ; 2966.0bp to feature; MODIFIER | silent_mutation | Average:64.074; most accessible tissue: Callus, score: 83.425 | N | N | N | N |
| vg0220854116 | G -> A | LOC_Os02g34780.1 | upstream_gene_variant ; 1058.0bp to feature; MODIFIER | silent_mutation | Average:64.074; most accessible tissue: Callus, score: 83.425 | N | N | N | N |
| vg0220854116 | G -> A | LOC_Os02g34790.1 | downstream_gene_variant ; 2928.0bp to feature; MODIFIER | silent_mutation | Average:64.074; most accessible tissue: Callus, score: 83.425 | N | N | N | N |
| vg0220854116 | G -> A | LOC_Os02g34780-LOC_Os02g34790 | intergenic_region ; MODIFIER | silent_mutation | Average:64.074; most accessible tissue: Callus, score: 83.425 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0220854116 | NA | 1.41E-18 | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220854116 | NA | 4.46E-07 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220854116 | NA | 3.04E-16 | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220854116 | NA | 1.39E-06 | mr1422 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220854116 | 5.75E-06 | 5.72E-06 | mr1869 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220854116 | 1.09E-06 | NA | mr1917 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220854116 | 5.46E-07 | 6.90E-08 | mr1917 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220854116 | 8.84E-06 | NA | mr1936 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |