\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220853972:

Variant ID: vg0220853972 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 20853972
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.07, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


ACTTAGTAATTCATAATTTCTAAACTAAATTAATAAAAAAACTCCAAAAAAAACAACAGTAAGGCTTTAGCGTGAATTAAAATCAGAATACAAAGAAAAA[C/T]
ATAATGCTTATAAAATTAATAGCAATAGCCCGTGCAACGCATGGGTTGTCGGCTAGTATAATTAGCAATAGATTGGGAGCCCATACATTCCCGATTACTC

Reverse complement sequence

GAGTAATCGGGAATGTATGGGCTCCCAATCTATTGCTAATTATACTAGCCGACAACCCATGCGTTGCACGGGCTATTGCTATTAATTTTATAAGCATTAT[G/A]
TTTTTCTTTGTATTCTGATTTTAATTCACGCTAAAGCCTTACTGTTGTTTTTTTTGGAGTTTTTTTATTAATTTAGTTTAGAAATTATGAATTACTAAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.70% 45.00% 0.32% 0.00% NA
All Indica  2759 88.40% 11.30% 0.36% 0.00% NA
All Japonica  1512 1.20% 98.80% 0.00% 0.00% NA
Aus  269 34.60% 64.70% 0.74% 0.00% NA
Indica I  595 99.20% 0.50% 0.34% 0.00% NA
Indica II  465 70.10% 29.70% 0.22% 0.00% NA
Indica III  913 92.00% 8.00% 0.00% 0.00% NA
Indica Intermediate  786 86.80% 12.30% 0.89% 0.00% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 34.40% 62.20% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0220853972 C -> T LOC_Os02g34770.1 upstream_gene_variant ; 2822.0bp to feature; MODIFIER silent_mutation Average:51.61; most accessible tissue: Callus, score: 89.044 N N N N
vg0220853972 C -> T LOC_Os02g34780.1 upstream_gene_variant ; 914.0bp to feature; MODIFIER silent_mutation Average:51.61; most accessible tissue: Callus, score: 89.044 N N N N
vg0220853972 C -> T LOC_Os02g34790.1 downstream_gene_variant ; 3072.0bp to feature; MODIFIER silent_mutation Average:51.61; most accessible tissue: Callus, score: 89.044 N N N N
vg0220853972 C -> T LOC_Os02g34780-LOC_Os02g34790 intergenic_region ; MODIFIER silent_mutation Average:51.61; most accessible tissue: Callus, score: 89.044 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0220853972 NA 5.85E-06 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220853972 NA 3.11E-12 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220853972 NA 2.41E-11 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220853972 NA 5.15E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220853972 6.22E-06 NA mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220853972 8.50E-06 9.77E-07 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220853972 3.59E-06 NA mr1936 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220853972 NA 8.51E-07 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251