\
| Variant ID: vg0220853972 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 20853972 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.07, others allele: 0.00, population size: 86. )
ACTTAGTAATTCATAATTTCTAAACTAAATTAATAAAAAAACTCCAAAAAAAACAACAGTAAGGCTTTAGCGTGAATTAAAATCAGAATACAAAGAAAAA[C/T]
ATAATGCTTATAAAATTAATAGCAATAGCCCGTGCAACGCATGGGTTGTCGGCTAGTATAATTAGCAATAGATTGGGAGCCCATACATTCCCGATTACTC
GAGTAATCGGGAATGTATGGGCTCCCAATCTATTGCTAATTATACTAGCCGACAACCCATGCGTTGCACGGGCTATTGCTATTAATTTTATAAGCATTAT[G/A]
TTTTTCTTTGTATTCTGATTTTAATTCACGCTAAAGCCTTACTGTTGTTTTTTTTGGAGTTTTTTTATTAATTTAGTTTAGAAATTATGAATTACTAAGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.70% | 45.00% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 88.40% | 11.30% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 34.60% | 64.70% | 0.74% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.50% | 0.34% | 0.00% | NA |
| Indica II | 465 | 70.10% | 29.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 92.00% | 8.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 86.80% | 12.30% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.30% | 96.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 34.40% | 62.20% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0220853972 | C -> T | LOC_Os02g34770.1 | upstream_gene_variant ; 2822.0bp to feature; MODIFIER | silent_mutation | Average:51.61; most accessible tissue: Callus, score: 89.044 | N | N | N | N |
| vg0220853972 | C -> T | LOC_Os02g34780.1 | upstream_gene_variant ; 914.0bp to feature; MODIFIER | silent_mutation | Average:51.61; most accessible tissue: Callus, score: 89.044 | N | N | N | N |
| vg0220853972 | C -> T | LOC_Os02g34790.1 | downstream_gene_variant ; 3072.0bp to feature; MODIFIER | silent_mutation | Average:51.61; most accessible tissue: Callus, score: 89.044 | N | N | N | N |
| vg0220853972 | C -> T | LOC_Os02g34780-LOC_Os02g34790 | intergenic_region ; MODIFIER | silent_mutation | Average:51.61; most accessible tissue: Callus, score: 89.044 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0220853972 | NA | 5.85E-06 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220853972 | NA | 3.11E-12 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220853972 | NA | 2.41E-11 | mr1609 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220853972 | NA | 5.15E-07 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220853972 | 6.22E-06 | NA | mr1917 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220853972 | 8.50E-06 | 9.77E-07 | mr1917 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220853972 | 3.59E-06 | NA | mr1936 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220853972 | NA | 8.51E-07 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |