\
| Variant ID: vg0220807490 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 20807490 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGCAGTGGGTCTTTTGGGTTGGAATGGAGCTATGGAGCAATAAAAACCCAGCTCCACCTCGTAGTCCATATTTAAGGAGTAGCTCTGCTAACTTCACTCC[T/C]
AAAAACATAGGATCTAAACCATTTGGCACAACTCCGGCTTAAAGCTGGAGTTAAGAGCTAGAGTTGTGCCAAACATGCCGAAAATGTGCTCTCTCTCTCT
AGAGAGAGAGAGCACATTTTCGGCATGTTTGGCACAACTCTAGCTCTTAACTCCAGCTTTAAGCCGGAGTTGTGCCAAATGGTTTAGATCCTATGTTTTT[A/G]
GGAGTGAAGTTAGCAGAGCTACTCCTTAAATATGGACTACGAGGTGGAGCTGGGTTTTTATTGCTCCATAGCTCCATTCCAACCCAAAAGACCCACTGCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.20% | 28.80% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 21.40% | 78.60% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 6.10% | 93.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 32.50% | 67.30% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 46.50% | 53.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 48.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0220807490 | T -> C | LOC_Os02g34690.1 | upstream_gene_variant ; 3850.0bp to feature; MODIFIER | silent_mutation | Average:56.475; most accessible tissue: Callus, score: 81.2 | N | N | N | N |
| vg0220807490 | T -> C | LOC_Os02g34680.1 | downstream_gene_variant ; 3016.0bp to feature; MODIFIER | silent_mutation | Average:56.475; most accessible tissue: Callus, score: 81.2 | N | N | N | N |
| vg0220807490 | T -> C | LOC_Os02g34680-LOC_Os02g34690 | intergenic_region ; MODIFIER | silent_mutation | Average:56.475; most accessible tissue: Callus, score: 81.2 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0220807490 | NA | 2.77E-43 | mr1563 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220807490 | NA | 5.11E-14 | mr1128_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220807490 | NA | 1.16E-08 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220807490 | NA | 4.01E-13 | mr1217_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220807490 | NA | 3.54E-06 | mr1232_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220807490 | NA | 2.84E-08 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220807490 | NA | 5.20E-07 | mr1557_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220807490 | NA | 3.82E-15 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220807490 | 2.53E-06 | 6.46E-48 | mr1670_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220807490 | NA | 2.71E-07 | mr1885_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220807490 | NA | 1.08E-07 | mr1909_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220807490 | NA | 2.54E-06 | mr1944_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |