Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0220806690:

Variant ID: vg0220806690 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 20806690
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


GATGAATTAAGCAGTGATAGCGTATTATGACCAATGCAGTTAAAATAACGACTACAACTTTAGCAGTGATAGCATATTATGACCGTTGGATCGATGCAGC[C/T]
AACAGCTTGGATCTACTCTGCCATCCCCTGCATAGTATACGCTACAGTGATTCGTGAACAGTATTTTCTGATGATCTGAGCCGCTGTTTTTGATCCATCG

Reverse complement sequence

CGATGGATCAAAAACAGCGGCTCAGATCATCAGAAAATACTGTTCACGAATCACTGTAGCGTATACTATGCAGGGGATGGCAGAGTAGATCCAAGCTGTT[G/A]
GCTGCATCGATCCAACGGTCATAATATGCTATCACTGCTAAAGTTGTAGTCGTTATTTTAACTGCATTGGTCATAATACGCTATCACTGCTTAATTCATC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.70% 45.70% 3.81% 1.78% NA
All Indica  2759 79.30% 11.70% 6.27% 2.75% NA
All Japonica  1512 1.10% 98.90% 0.00% 0.00% NA
Aus  269 27.10% 68.40% 1.49% 2.97% NA
Indica I  595 82.70% 0.80% 13.95% 2.52% NA
Indica II  465 64.70% 31.00% 3.01% 1.29% NA
Indica III  913 84.20% 9.20% 2.85% 3.72% NA
Indica Intermediate  786 79.60% 11.30% 6.36% 2.67% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 25.60% 71.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0220806690 C -> T LOC_Os02g34690.1 upstream_gene_variant ; 4650.0bp to feature; MODIFIER silent_mutation Average:87.833; most accessible tissue: Callus, score: 95.186 N N N N
vg0220806690 C -> T LOC_Os02g34680.1 downstream_gene_variant ; 2216.0bp to feature; MODIFIER silent_mutation Average:87.833; most accessible tissue: Callus, score: 95.186 N N N N
vg0220806690 C -> T LOC_Os02g34680-LOC_Os02g34690 intergenic_region ; MODIFIER silent_mutation Average:87.833; most accessible tissue: Callus, score: 95.186 N N N N
vg0220806690 C -> DEL N N silent_mutation Average:87.833; most accessible tissue: Callus, score: 95.186 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0220806690 C T -0.02 -0.03 -0.02 -0.02 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0220806690 NA 6.86E-06 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220806690 NA 2.97E-06 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220806690 NA 7.07E-06 mr1117 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220806690 NA 2.55E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220806690 NA 2.93E-14 mr1281 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220806690 4.68E-06 2.17E-06 mr1281 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220806690 NA 1.99E-10 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220806690 NA 6.39E-07 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220806690 NA 1.41E-19 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220806690 NA 5.50E-13 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220806690 NA 8.77E-08 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220806690 NA 2.98E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220806690 NA 5.83E-15 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220806690 NA 9.57E-06 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220806690 NA 1.99E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251